Incidental Mutation 'R9094:Blnk'
ID 691249
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene Name B cell linker
Synonyms BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9094 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 40928927-40994535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40994039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 7 (I7T)
Ref Sequence ENSEMBL: ENSMUSP00000057844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
AlphaFold Q9QUN3
PDB Structure Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054769
AA Change: I7T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: I7T

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117695
AA Change: I7T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: I7T

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik T C 4: 108,780,547 V37A unknown Het
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Abi3bp A G 16: 56,636,227 I1021V probably benign Het
Agrn C A 4: 156,168,807 K1848N probably benign Het
Anln A G 9: 22,337,987 V1005A probably benign Het
Arid3b A G 9: 57,834,044 Y40H probably damaging Het
Bco1 A C 8: 117,133,178 D540A probably benign Het
Brca2 T G 5: 150,552,305 D2493E probably benign Het
Bsn T A 9: 108,110,853 M2567L unknown Het
Cacna1e T A 1: 154,479,318 Y693F possibly damaging Het
Catsperg1 G C 7: 29,184,727 T987R probably damaging Het
Cpa4 G T 6: 30,574,394 D61Y possibly damaging Het
Cpne1 A C 2: 156,079,160 V70G probably damaging Het
Dnase1l3 A T 14: 7,987,306 N81K probably damaging Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
Fam172a A G 13: 78,163,606 K356R possibly damaging Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fbxo34 C G 14: 47,530,471 H480Q probably benign Het
Frmd4b T C 6: 97,421,598 E96G Het
Gdpgp1 T A 7: 80,238,468 D82E probably benign Het
Gjb3 GCCAGATGCGCCCA GCCAGATGCGCCCAGATGCGCCCA 4: 127,326,665 probably null Het
Gjb3 AGATGCGCCC AGATGCGCCCCGATGCGCCC 4: 127,326,668 probably null Het
Grpel1 A G 5: 36,469,479 N35S probably benign Het
Il12rb1 A G 8: 70,820,647 T665A possibly damaging Het
Il16 T C 7: 83,652,351 T886A probably benign Het
Insig1 T A 5: 28,073,572 C128* probably null Het
Kcnk10 T A 12: 98,518,516 E120D probably benign Het
Kctd1 T C 18: 15,062,312 N418S possibly damaging Het
Kif1bp A G 10: 62,559,258 V535A probably damaging Het
Klhl20 T A 1: 161,105,485 H251L probably damaging Het
Ldlrad3 T C 2: 102,057,981 D127G probably damaging Het
Lrp3 T C 7: 35,203,757 Y388C probably damaging Het
Lrrc4 G A 6: 28,830,207 R47W possibly damaging Het
Luzp1 A T 4: 136,545,251 D1022V probably damaging Het
Mllt1 C A 17: 56,905,737 R132L probably damaging Het
Ncoa1 G T 12: 4,295,494 H618N possibly damaging Het
Nelfcd T C 2: 174,424,068 S318P probably damaging Het
Ngly1 A C 14: 16,280,721 T301P probably damaging Het
Npy5r G A 8: 66,680,908 T411I probably damaging Het
Olfr1176 A G 2: 88,339,904 N113S probably benign Het
Olfr545 T C 7: 102,494,361 E138G possibly damaging Het
Pcdha6 T A 18: 36,968,540 I262N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pm20d1 C A 1: 131,802,743 A245D possibly damaging Het
Rbms2 T A 10: 128,151,238 I62F probably damaging Het
Rev3l A T 10: 39,824,813 T1769S probably benign Het
Rexo1 A G 10: 80,543,020 Y1061H probably damaging Het
Rgs3 A T 4: 62,582,003 I26F probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtkn A T 6: 83,151,037 N406Y possibly damaging Het
Rtn4r A T 16: 18,151,844 I379F possibly damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sorl1 A T 9: 42,063,754 N519K possibly damaging Het
Srebf2 A T 15: 82,172,774 I237F possibly damaging Het
Szt2 T C 4: 118,385,454 S1479G possibly damaging Het
Tbc1d24 C A 17: 24,181,300 E537* probably null Het
Ttf1 T A 2: 29,067,068 I450K probably benign Het
Ube2e2 A G 14: 18,893,288 S2P unknown Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn2r25 C T 6: 123,828,432 V489I probably benign Het
Wfdc8 C T 2: 164,597,325 R379H unknown Het
Zeb2 C T 2: 45,113,124 probably benign Het
Zfp3 C T 11: 70,772,415 T400I probably benign Het
Zfp760 T C 17: 21,722,951 I369T possibly damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8473:Blnk UTSW 19 40952410 missense possibly damaging 0.81
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
R9139:Blnk UTSW 19 40934518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGGTTCCTTCACTCC -3'
(R):5'- AACATGAAACTTGGCGATGC -3'

Sequencing Primer
(F):5'- CTCCTACACGTTTCTTTAAAAAGCTG -3'
(R):5'- AGCGAGTTTTACTTCCCCTGTG -3'
Posted On 2021-12-30