Mutagenetix > Incidental Mutations

Incidental Mutation 'R9094:Blnk'

691249

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R9094 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40994039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 7 (I7T)

Ref Sequence

ENSEMBL: ENSMUSP00000057844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

PDB Structure

Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000054769
AA Change: I7T

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: I7T

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117695
AA Change: I7T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: I7T

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110021N24Rik	T	C	4: 108,780,547	V37A	unknown	Het
3425401B19Rik	G	A	14: 32,660,657	S1117L	possibly damaging	Het
Abi3bp	A	G	16: 56,636,227	I1021V	probably benign	Het
Agrn	C	A	4: 156,168,807	K1848N	probably benign	Het
Anln	A	G	9: 22,337,987	V1005A	probably benign	Het
Arid3b	A	G	9: 57,834,044	Y40H	probably damaging	Het
Bco1	A	C	8: 117,133,178	D540A	probably benign	Het
Brca2	T	G	5: 150,552,305	D2493E	probably benign	Het
Bsn	T	A	9: 108,110,853	M2567L	unknown	Het
Cacna1e	T	A	1: 154,479,318	Y693F	possibly damaging	Het
Catsperg1	G	C	7: 29,184,727	T987R	probably damaging	Het
Cpa4	G	T	6: 30,574,394	D61Y	possibly damaging	Het
Cpne1	A	C	2: 156,079,160	V70G	probably damaging	Het
Dnase1l3	A	T	14: 7,987,306	N81K	probably damaging	Het
Duxf3	GCCC	GCC	10: 58,231,122		probably null	Het
Fam172a	A	G	13: 78,163,606	K356R	possibly damaging	Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Fbxo34	C	G	14: 47,530,471	H480Q	probably benign	Het
Frmd4b	T	C	6: 97,421,598	E96G		Het
Gdpgp1	T	A	7: 80,238,468	D82E	probably benign	Het
Gjb3	GCCAGATGCGCCCA	GCCAGATGCGCCCAGATGCGCCCA	4: 127,326,665		probably null	Het
Gjb3	AGATGCGCCC	AGATGCGCCCCGATGCGCCC	4: 127,326,668		probably null	Het
Grpel1	A	G	5: 36,469,479	N35S	probably benign	Het
Il12rb1	A	G	8: 70,820,647	T665A	possibly damaging	Het
Il16	T	C	7: 83,652,351	T886A	probably benign	Het
Insig1	T	A	5: 28,073,572	C128*	probably null	Het
Kcnk10	T	A	12: 98,518,516	E120D	probably benign	Het
Kctd1	T	C	18: 15,062,312	N418S	possibly damaging	Het
Kif1bp	A	G	10: 62,559,258	V535A	probably damaging	Het
Klhl20	T	A	1: 161,105,485	H251L	probably damaging	Het
Ldlrad3	T	C	2: 102,057,981	D127G	probably damaging	Het
Lrp3	T	C	7: 35,203,757	Y388C	probably damaging	Het
Lrrc4	G	A	6: 28,830,207	R47W	possibly damaging	Het
Luzp1	A	T	4: 136,545,251	D1022V	probably damaging	Het
Mllt1	C	A	17: 56,905,737	R132L	probably damaging	Het
Ncoa1	G	T	12: 4,295,494	H618N	possibly damaging	Het
Nelfcd	T	C	2: 174,424,068	S318P	probably damaging	Het
Ngly1	A	C	14: 16,280,721	T301P	probably damaging	Het
Npy5r	G	A	8: 66,680,908	T411I	probably damaging	Het
Olfr1176	A	G	2: 88,339,904	N113S	probably benign	Het
Olfr545	T	C	7: 102,494,361	E138G	possibly damaging	Het
Pcdha6	T	A	18: 36,968,540	I262N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Pm20d1	C	A	1: 131,802,743	A245D	possibly damaging	Het
Rbms2	T	A	10: 128,151,238	I62F	probably damaging	Het
Rev3l	A	T	10: 39,824,813	T1769S	probably benign	Het
Rexo1	A	G	10: 80,543,020	Y1061H	probably damaging	Het
Rgs3	A	T	4: 62,582,003	I26F	probably damaging	Het
Rsf1	G	GACGGCGGCC	7: 97,579,909		probably benign	Het
Rtkn	A	T	6: 83,151,037	N406Y	possibly damaging	Het
Rtn4r	A	T	16: 18,151,844	I379F	possibly damaging	Het
Sez6	G	A	11: 77,974,295	E623K	possibly damaging	Het
Sorl1	A	T	9: 42,063,754	N519K	possibly damaging	Het
Srebf2	A	T	15: 82,172,774	I237F	possibly damaging	Het
Szt2	T	C	4: 118,385,454	S1479G	possibly damaging	Het
Tbc1d24	C	A	17: 24,181,300	E537*	probably null	Het
Ttf1	T	A	2: 29,067,068	I450K	probably benign	Het
Ube2e2	A	G	14: 18,893,288	S2P	unknown	Het
Utp20	T	C	10: 88,775,318	N1379S	probably damaging	Het
Vmn2r25	C	T	6: 123,828,432	V489I	probably benign	Het
Wfdc8	C	T	2: 164,597,325	R379H	unknown	Het
Zeb2	C	T	2: 45,113,124		probably benign	Het
Zfp3	C	T	11: 70,772,415	T400I	probably benign	Het
Zfp760	T	C	17: 21,722,951	I369T	possibly damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81
R8798:Blnk	UTSW	19	40962351	missense	probably damaging	1.00
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAAGCAGGTTCCTTCACTCC -3'
(R):5'- AACATGAAACTTGGCGATGC -3'

Sequencing Primer
(F):5'- CTCCTACACGTTTCTTTAAAAAGCTG -3'
(R):5'- AGCGAGTTTTACTTCCCCTGTG -3'

Posted On

2021-12-30