Incidental Mutation 'R9095:Olfr539'
ID 691294
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9095 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 140667900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 197 (N197K)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably damaging
Transcript: ENSMUST00000078967
AA Change: N204K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: N204K

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218865
AA Change: N197K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,104 N99Y possibly damaging Het
4931406P16Rik A T 7: 34,257,345 probably null Het
Abca17 C T 17: 24,281,396 V1274M probably damaging Het
Abca4 A G 3: 122,173,907 H2202R possibly damaging Het
Ablim3 A G 18: 61,820,392 L350P probably benign Het
Adamts17 C T 7: 67,004,369 T449I probably damaging Het
Ankrd39 T A 1: 36,547,160 D9V probably benign Het
Arhgef7 T C 8: 11,785,819 V192A probably damaging Het
Art4 C T 6: 136,857,271 probably benign Het
Atg4a-ps A T 3: 103,645,938 V29E possibly damaging Het
Casc4 T A 2: 121,925,615 L375Q probably damaging Het
Ccdc180 A T 4: 45,949,466 K1574* probably null Het
Cfap54 T G 10: 93,011,020 T1028P probably damaging Het
Clip2 C T 5: 134,503,400 R517H possibly damaging Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Cpne1 T A 2: 156,076,290 probably null Het
Cyp2f2 T A 7: 27,131,242 M346K possibly damaging Het
D130040H23Rik AAGAATATATTCTACAGAATATA AAGAATATA 8: 69,303,096 probably null Het
Ddi2 T A 4: 141,692,279 I387F probably benign Het
Dsg1b A G 18: 20,390,225 N103S probably damaging Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
Dysf A G 6: 84,179,684 I1464V probably benign Het
Epha2 A G 4: 141,316,701 Y314C possibly damaging Het
Etl4 A G 2: 20,778,153 E675G probably damaging Het
Fam114a1 A C 5: 65,031,390 I488L probably benign Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fn1 A C 1: 71,607,990 I1547S probably null Het
Gm10031 A T 1: 156,524,643 Y138F probably benign Het
Gm13083 T C 4: 143,615,190 F63S probably damaging Het
Gm14305 T A 2: 176,721,252 Y312* probably null Het
Gpihbp1 A G 15: 75,597,792 T119A possibly damaging Het
Harbi1 T G 2: 91,712,635 V147G probably damaging Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Ighv13-2 C A 12: 114,357,874 A82S probably benign Het
Itpr1 T A 6: 108,387,391 D827E probably benign Het
Krtap4-2 C T 11: 99,634,975 G17D unknown Het
Ly6a A T 15: 74,995,484 probably benign Het
Mad1l1 C T 5: 140,302,986 E203K probably damaging Het
Mapk14 C A 17: 28,715,439 D101E probably benign Het
Meis3 G T 7: 16,183,839 G306W probably damaging Het
Mixl1 T C 1: 180,696,837 D59G probably benign Het
Nav2 G A 7: 49,604,545 V2364M probably damaging Het
Nell1 T C 7: 50,856,402 S786P possibly damaging Het
Olfr1461 T G 19: 13,165,946 S311A probably benign Het
Olfr578 A G 7: 102,984,480 L228P probably damaging Het
Olfr78 C A 7: 102,742,266 V246L possibly damaging Het
Pcdhgb8 A T 18: 37,762,999 D374V probably damaging Het
Phactr2 A G 10: 13,253,642 I294T probably benign Het
Plekha4 C T 7: 45,541,068 A400V probably damaging Het
Pramel4 C A 4: 144,068,358 D441E probably benign Het
Prr12 G A 7: 45,045,843 P1400S unknown Het
Rbm6 G A 9: 107,791,890 Q608* probably null Het
Scamp1 T A 13: 94,233,090 I76F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sirt1 A T 10: 63,322,298 S446T probably damaging Het
Slc25a54 A G 3: 109,112,088 K336R probably benign Het
Spag17 G T 3: 100,004,776 V321F possibly damaging Het
Sstr1 A G 12: 58,212,834 Y81C probably damaging Het
St8sia4 T C 1: 95,591,800 K321R probably damaging Het
Stac3 T C 10: 127,507,715 F242S probably damaging Het
Tanc2 T G 11: 105,867,278 S622A probably benign Het
Tcf4 G A 18: 69,465,393 D106N possibly damaging Het
Tfrc T A 16: 32,614,753 I75N possibly damaging Het
Tigd2 G A 6: 59,210,524 W125* probably null Het
Tjp1 T C 7: 65,302,997 T1530A possibly damaging Het
Tmem132a T A 19: 10,867,048 H62L probably benign Het
Tmem89 T C 9: 108,914,661 S10P unknown Het
Trrap C T 5: 144,797,151 P938L probably damaging Het
Unc80 C A 1: 66,506,753 P488T probably damaging Het
Uri1 C A 7: 37,963,448 G374C probably damaging Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vcan G T 13: 89,704,525 T772K probably benign Het
Wrb T A 16: 96,153,044 probably benign Het
Zbtb37 A T 1: 161,020,371 Y355* probably null Het
Zfp3 A G 11: 70,771,579 I121M probably benign Het
Zfp629 A T 7: 127,610,375 L754Q probably damaging Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9158:Olfr539 UTSW 7 140667634 missense possibly damaging 0.76
R9603:Olfr539 UTSW 7 140667881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTATGTGGCTATCTGC -3'
(R):5'- TAGATGAGTAGTACACAGAGACCAC -3'

Sequencing Primer
(F):5'- CTACACTACAGCTCTAGGATGAG -3'
(R):5'- TACACAGAGACCACAATGAGGTG -3'
Posted On 2021-12-30