Incidental Mutation 'R9095:Cfap54'
ID 691304
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9095 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 92775619-93081618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 93011020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1028 (T1028P)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000168110
AA Change: T1028P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: T1028P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
Predicted Effect probably damaging
Transcript: ENSMUST00000212902
AA Change: T1028P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,104 N99Y possibly damaging Het
4931406P16Rik A T 7: 34,257,345 probably null Het
Abca17 C T 17: 24,281,396 V1274M probably damaging Het
Abca4 A G 3: 122,173,907 H2202R possibly damaging Het
Ablim3 A G 18: 61,820,392 L350P probably benign Het
Adamts17 C T 7: 67,004,369 T449I probably damaging Het
Ankrd39 T A 1: 36,547,160 D9V probably benign Het
Arhgef7 T C 8: 11,785,819 V192A probably damaging Het
Art4 C T 6: 136,857,271 probably benign Het
Atg4a-ps A T 3: 103,645,938 V29E possibly damaging Het
Casc4 T A 2: 121,925,615 L375Q probably damaging Het
Ccdc180 A T 4: 45,949,466 K1574* probably null Het
Clip2 C T 5: 134,503,400 R517H possibly damaging Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Cpne1 T A 2: 156,076,290 probably null Het
Cyp2f2 T A 7: 27,131,242 M346K possibly damaging Het
D130040H23Rik AAGAATATATTCTACAGAATATA AAGAATATA 8: 69,303,096 probably null Het
Ddi2 T A 4: 141,692,279 I387F probably benign Het
Dsg1b A G 18: 20,390,225 N103S probably damaging Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
Dysf A G 6: 84,179,684 I1464V probably benign Het
Epha2 A G 4: 141,316,701 Y314C possibly damaging Het
Etl4 A G 2: 20,778,153 E675G probably damaging Het
Fam114a1 A C 5: 65,031,390 I488L probably benign Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fn1 A C 1: 71,607,990 I1547S probably null Het
Gm10031 A T 1: 156,524,643 Y138F probably benign Het
Gm13083 T C 4: 143,615,190 F63S probably damaging Het
Gm14305 T A 2: 176,721,252 Y312* probably null Het
Gpihbp1 A G 15: 75,597,792 T119A possibly damaging Het
Harbi1 T G 2: 91,712,635 V147G probably damaging Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Ighv13-2 C A 12: 114,357,874 A82S probably benign Het
Itpr1 T A 6: 108,387,391 D827E probably benign Het
Krtap4-2 C T 11: 99,634,975 G17D unknown Het
Ly6a A T 15: 74,995,484 probably benign Het
Mad1l1 C T 5: 140,302,986 E203K probably damaging Het
Mapk14 C A 17: 28,715,439 D101E probably benign Het
Meis3 G T 7: 16,183,839 G306W probably damaging Het
Mixl1 T C 1: 180,696,837 D59G probably benign Het
Nav2 G A 7: 49,604,545 V2364M probably damaging Het
Nell1 T C 7: 50,856,402 S786P possibly damaging Het
Olfr1461 T G 19: 13,165,946 S311A probably benign Het
Olfr539 T G 7: 140,667,900 N197K probably damaging Het
Olfr578 A G 7: 102,984,480 L228P probably damaging Het
Olfr78 C A 7: 102,742,266 V246L possibly damaging Het
Pcdhgb8 A T 18: 37,762,999 D374V probably damaging Het
Phactr2 A G 10: 13,253,642 I294T probably benign Het
Plekha4 C T 7: 45,541,068 A400V probably damaging Het
Pramel4 C A 4: 144,068,358 D441E probably benign Het
Prr12 G A 7: 45,045,843 P1400S unknown Het
Rbm6 G A 9: 107,791,890 Q608* probably null Het
Scamp1 T A 13: 94,233,090 I76F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sirt1 A T 10: 63,322,298 S446T probably damaging Het
Slc25a54 A G 3: 109,112,088 K336R probably benign Het
Spag17 G T 3: 100,004,776 V321F possibly damaging Het
Sstr1 A G 12: 58,212,834 Y81C probably damaging Het
St8sia4 T C 1: 95,591,800 K321R probably damaging Het
Stac3 T C 10: 127,507,715 F242S probably damaging Het
Tanc2 T G 11: 105,867,278 S622A probably benign Het
Tcf4 G A 18: 69,465,393 D106N possibly damaging Het
Tfrc T A 16: 32,614,753 I75N possibly damaging Het
Tigd2 G A 6: 59,210,524 W125* probably null Het
Tjp1 T C 7: 65,302,997 T1530A possibly damaging Het
Tmem132a T A 19: 10,867,048 H62L probably benign Het
Tmem89 T C 9: 108,914,661 S10P unknown Het
Trrap C T 5: 144,797,151 P938L probably damaging Het
Unc80 C A 1: 66,506,753 P488T probably damaging Het
Uri1 C A 7: 37,963,448 G374C probably damaging Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vcan G T 13: 89,704,525 T772K probably benign Het
Wrb T A 16: 96,153,044 probably benign Het
Zbtb37 A T 1: 161,020,371 Y355* probably null Het
Zfp3 A G 11: 70,771,579 I121M probably benign Het
Zfp629 A T 7: 127,610,375 L754Q probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7980:Cfap54 UTSW 10 92982060 missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92902079 missense unknown
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
R8920:Cfap54 UTSW 10 92940337 critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 93001823 missense probably damaging 0.99
R8954:Cfap54 UTSW 10 93043393 missense probably damaging 1.00
R8963:Cfap54 UTSW 10 93028700 nonsense probably null
R9010:Cfap54 UTSW 10 92899059 missense unknown
R9017:Cfap54 UTSW 10 92816021 missense probably benign 0.07
R9093:Cfap54 UTSW 10 92815908 missense probably benign 0.03
R9142:Cfap54 UTSW 10 92984235 missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92994717 missense probably benign 0.10
R9196:Cfap54 UTSW 10 93037891 missense probably benign 0.22
R9203:Cfap54 UTSW 10 93045128 missense probably benign 0.30
R9258:Cfap54 UTSW 10 92935098 missense unknown
R9275:Cfap54 UTSW 10 93039186 missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92969703 missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92821074 missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92962315 missense unknown
R9397:Cfap54 UTSW 10 92997285 missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92902058 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTACATTTGTGCTCCTGGG -3'
(R):5'- TTCACAGATACCAGCCGATG -3'

Sequencing Primer
(F):5'- CTATAGAAGGCAAATTCACTAACGG -3'
(R):5'- CCGATGGCAGAAGCTTCTTTG -3'
Posted On 2021-12-30