Mutagenetix > Incidental Mutations

Incidental Mutation 'R9095:Abca17'

691316

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9095 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24281396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1274 (V1274M)

Ref Sequence

ENSEMBL: ENSMUSP00000046218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

probably damaging
Transcript: ENSMUST00000039324
AA Change: V1274M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V1274M

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121226
AA Change: V1274M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V1274M

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	T	A	6: 41,033,104	N99Y	possibly damaging	Het
4931406P16Rik	A	T	7: 34,257,345		probably null	Het
Abca4	A	G	3: 122,173,907	H2202R	possibly damaging	Het
Ablim3	A	G	18: 61,820,392	L350P	probably benign	Het
Adamts17	C	T	7: 67,004,369	T449I	probably damaging	Het
Ankrd39	T	A	1: 36,547,160	D9V	probably benign	Het
Arhgef7	T	C	8: 11,785,819	V192A	probably damaging	Het
Art4	C	T	6: 136,857,271		probably benign	Het
Atg4a-ps	A	T	3: 103,645,938	V29E	possibly damaging	Het
Casc4	T	A	2: 121,925,615	L375Q	probably damaging	Het
Ccdc180	A	T	4: 45,949,466	K1574*	probably null	Het
Cfap54	T	G	10: 93,011,020	T1028P	probably damaging	Het
Clip2	C	T	5: 134,503,400	R517H	possibly damaging	Het
Col5a1	A	G	2: 28,024,653	T94A	probably benign	Het
Cpne1	T	A	2: 156,076,290		probably null	Het
Cyp2f2	T	A	7: 27,131,242	M346K	possibly damaging	Het
D130040H23Rik	AAGAATATATTCTACAGAATATA	AAGAATATA	8: 69,303,096		probably null	Het
Ddi2	T	A	4: 141,692,279	I387F	probably benign	Het
Dsg1b	A	G	18: 20,390,225	N103S	probably damaging	Het
Duxf3	GCCC	GCC	10: 58,231,122		probably null	Het
Dysf	A	G	6: 84,179,684	I1464V	probably benign	Het
Epha2	A	G	4: 141,316,701	Y314C	possibly damaging	Het
Etl4	A	G	2: 20,778,153	E675G	probably damaging	Het
Fam114a1	A	C	5: 65,031,390	I488L	probably benign	Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Fn1	A	C	1: 71,607,990	I1547S	probably null	Het
Gm10031	A	T	1: 156,524,643	Y138F	probably benign	Het
Gm13083	T	C	4: 143,615,190	F63S	probably damaging	Het
Gm14305	T	A	2: 176,721,252	Y312*	probably null	Het
Gpihbp1	A	G	15: 75,597,792	T119A	possibly damaging	Het
Harbi1	T	G	2: 91,712,635	V147G	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,499	Y186C	probably damaging	Het
Ighv13-2	C	A	12: 114,357,874	A82S	probably benign	Het
Itpr1	T	A	6: 108,387,391	D827E	probably benign	Het
Krtap4-2	C	T	11: 99,634,975	G17D	unknown	Het
Mad1l1	C	T	5: 140,302,986	E203K	probably damaging	Het
Mapk14	C	A	17: 28,715,439	D101E	probably benign	Het
Meis3	G	T	7: 16,183,839	G306W	probably damaging	Het
Mixl1	T	C	1: 180,696,837	D59G	probably benign	Het
Nav2	G	A	7: 49,604,545	V2364M	probably damaging	Het
Nell1	T	C	7: 50,856,402	S786P	possibly damaging	Het
Olfr1461	T	G	19: 13,165,946	S311A	probably benign	Het
Olfr539	T	G	7: 140,667,900	N197K	probably damaging	Het
Olfr578	A	G	7: 102,984,480	L228P	probably damaging	Het
Olfr78	C	A	7: 102,742,266	V246L	possibly damaging	Het
Pcdhgb8	A	T	18: 37,762,999	D374V	probably damaging	Het
Phactr2	A	G	10: 13,253,642	I294T	probably benign	Het
Plekha4	C	T	7: 45,541,068	A400V	probably damaging	Het
Pramel4	C	A	4: 144,068,358	D441E	probably benign	Het
Prr12	G	A	7: 45,045,843	P1400S	unknown	Het
Rbm6	G	A	9: 107,791,890	Q608*	probably null	Het
Scamp1	T	A	13: 94,233,090	I76F	probably benign	Het
Sez6	G	A	11: 77,974,295	E623K	possibly damaging	Het
Sirt1	A	T	10: 63,322,298	S446T	probably damaging	Het
Slc25a54	A	G	3: 109,112,088	K336R	probably benign	Het
Spag17	G	T	3: 100,004,776	V321F	possibly damaging	Het
Sstr1	A	G	12: 58,212,834	Y81C	probably damaging	Het
St8sia4	T	C	1: 95,591,800	K321R	probably damaging	Het
Stac3	T	C	10: 127,507,715	F242S	probably damaging	Het
Tanc2	T	G	11: 105,867,278	S622A	probably benign	Het
Tcf4	G	A	18: 69,465,393	D106N	possibly damaging	Het
Tfrc	T	A	16: 32,614,753	I75N	possibly damaging	Het
Tigd2	G	A	6: 59,210,524	W125*	probably null	Het
Tjp1	T	C	7: 65,302,997	T1530A	possibly damaging	Het
Tmem132a	T	A	19: 10,867,048	H62L	probably benign	Het
Tmem89	T	C	9: 108,914,661	S10P	unknown	Het
Trrap	C	T	5: 144,797,151	P938L	probably damaging	Het
Unc80	C	A	1: 66,506,753	P488T	probably damaging	Het
Uri1	C	A	7: 37,963,448	G374C	probably damaging	Het
Utp20	T	C	10: 88,775,318	N1379S	probably damaging	Het
Vcan	G	T	13: 89,704,525	T772K	probably benign	Het
Zbtb37	A	T	1: 161,020,371	Y355*	probably null	Het
Zfp3	A	G	11: 70,771,579	I121M	probably benign	Het
Zfp629	A	T	7: 127,610,375	L754Q	probably damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAGAGCCAGACCTTGACCTG -3'
(R):5'- GCAGCAAGCAAAGGCATTCTTG -3'

Sequencing Primer
(F):5'- AGACCTTGACCTGTTTTTACATGAC -3'
(R):5'- TGCTCACCCTCTGCTAGG -3'

Posted On

2021-12-30