Incidental Mutation 'R9095:Abca17'
ID 691316
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9095 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24281396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1274 (V1274M)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: V1274M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V1274M

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: V1274M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V1274M

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,104 N99Y possibly damaging Het
4931406P16Rik A T 7: 34,257,345 probably null Het
Abca4 A G 3: 122,173,907 H2202R possibly damaging Het
Ablim3 A G 18: 61,820,392 L350P probably benign Het
Adamts17 C T 7: 67,004,369 T449I probably damaging Het
Ankrd39 T A 1: 36,547,160 D9V probably benign Het
Arhgef7 T C 8: 11,785,819 V192A probably damaging Het
Art4 C T 6: 136,857,271 probably benign Het
Atg4a-ps A T 3: 103,645,938 V29E possibly damaging Het
Casc4 T A 2: 121,925,615 L375Q probably damaging Het
Ccdc180 A T 4: 45,949,466 K1574* probably null Het
Cfap54 T G 10: 93,011,020 T1028P probably damaging Het
Clip2 C T 5: 134,503,400 R517H possibly damaging Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Cpne1 T A 2: 156,076,290 probably null Het
Cyp2f2 T A 7: 27,131,242 M346K possibly damaging Het
D130040H23Rik AAGAATATATTCTACAGAATATA AAGAATATA 8: 69,303,096 probably null Het
Ddi2 T A 4: 141,692,279 I387F probably benign Het
Dsg1b A G 18: 20,390,225 N103S probably damaging Het
Duxf3 GCCC GCC 10: 58,231,122 probably null Het
Dysf A G 6: 84,179,684 I1464V probably benign Het
Epha2 A G 4: 141,316,701 Y314C possibly damaging Het
Etl4 A G 2: 20,778,153 E675G probably damaging Het
Fam114a1 A C 5: 65,031,390 I488L probably benign Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fn1 A C 1: 71,607,990 I1547S probably null Het
Gm10031 A T 1: 156,524,643 Y138F probably benign Het
Gm13083 T C 4: 143,615,190 F63S probably damaging Het
Gm14305 T A 2: 176,721,252 Y312* probably null Het
Gpihbp1 A G 15: 75,597,792 T119A possibly damaging Het
Harbi1 T G 2: 91,712,635 V147G probably damaging Het
Ifit1bl1 T C 19: 34,594,499 Y186C probably damaging Het
Ighv13-2 C A 12: 114,357,874 A82S probably benign Het
Itpr1 T A 6: 108,387,391 D827E probably benign Het
Krtap4-2 C T 11: 99,634,975 G17D unknown Het
Mad1l1 C T 5: 140,302,986 E203K probably damaging Het
Mapk14 C A 17: 28,715,439 D101E probably benign Het
Meis3 G T 7: 16,183,839 G306W probably damaging Het
Mixl1 T C 1: 180,696,837 D59G probably benign Het
Nav2 G A 7: 49,604,545 V2364M probably damaging Het
Nell1 T C 7: 50,856,402 S786P possibly damaging Het
Olfr1461 T G 19: 13,165,946 S311A probably benign Het
Olfr539 T G 7: 140,667,900 N197K probably damaging Het
Olfr578 A G 7: 102,984,480 L228P probably damaging Het
Olfr78 C A 7: 102,742,266 V246L possibly damaging Het
Pcdhgb8 A T 18: 37,762,999 D374V probably damaging Het
Phactr2 A G 10: 13,253,642 I294T probably benign Het
Plekha4 C T 7: 45,541,068 A400V probably damaging Het
Pramel4 C A 4: 144,068,358 D441E probably benign Het
Prr12 G A 7: 45,045,843 P1400S unknown Het
Rbm6 G A 9: 107,791,890 Q608* probably null Het
Scamp1 T A 13: 94,233,090 I76F probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sirt1 A T 10: 63,322,298 S446T probably damaging Het
Slc25a54 A G 3: 109,112,088 K336R probably benign Het
Spag17 G T 3: 100,004,776 V321F possibly damaging Het
Sstr1 A G 12: 58,212,834 Y81C probably damaging Het
St8sia4 T C 1: 95,591,800 K321R probably damaging Het
Stac3 T C 10: 127,507,715 F242S probably damaging Het
Tanc2 T G 11: 105,867,278 S622A probably benign Het
Tcf4 G A 18: 69,465,393 D106N possibly damaging Het
Tfrc T A 16: 32,614,753 I75N possibly damaging Het
Tigd2 G A 6: 59,210,524 W125* probably null Het
Tjp1 T C 7: 65,302,997 T1530A possibly damaging Het
Tmem132a T A 19: 10,867,048 H62L probably benign Het
Tmem89 T C 9: 108,914,661 S10P unknown Het
Trrap C T 5: 144,797,151 P938L probably damaging Het
Unc80 C A 1: 66,506,753 P488T probably damaging Het
Uri1 C A 7: 37,963,448 G374C probably damaging Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vcan G T 13: 89,704,525 T772K probably benign Het
Zbtb37 A T 1: 161,020,371 Y355* probably null Het
Zfp3 A G 11: 70,771,579 I121M probably benign Het
Zfp629 A T 7: 127,610,375 L754Q probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGCCAGACCTTGACCTG -3'
(R):5'- GCAGCAAGCAAAGGCATTCTTG -3'

Sequencing Primer
(F):5'- AGACCTTGACCTGTTTTTACATGAC -3'
(R):5'- TGCTCACCCTCTGCTAGG -3'
Posted On 2021-12-30