Incidental Mutation 'R9096:Mrc2'
ID 691370
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Name mannose receptor, C type 2
Synonyms Endo180, uPARAP, novel lectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9096 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 105292643-105351139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105340572 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 777 (D777G)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
AlphaFold Q64449
Predicted Effect probably damaging
Transcript: ENSMUST00000021038
AA Change: D777G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: D777G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100335
AA Change: D777G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: D777G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,191,927 V73E Het
Abhd12b T A 12: 70,163,433 Y128N probably damaging Het
Arhgap40 A T 2: 158,547,664 M586L probably benign Het
Armt1 T C 10: 4,434,829 S15P probably damaging Het
Arnt G T 3: 95,490,277 S535I probably benign Het
Bmper T C 9: 23,223,692 S18P possibly damaging Het
Catsperg1 G C 7: 29,184,727 T987R probably damaging Het
Col9a1 A T 1: 24,185,126 I130F unknown Het
Dennd1a G T 2: 37,800,065 L1008I probably damaging Het
Depdc1a T A 3: 159,498,480 D55E probably benign Het
Dlc1 A T 8: 36,613,567 I10N probably benign Het
Dnah1 T A 14: 31,261,070 I4203F probably damaging Het
Dzank1 G T 2: 144,474,962 L767I possibly damaging Het
Eprs C A 1: 185,407,106 A896E probably benign Het
Fryl T C 5: 73,108,577 D467G probably benign Het
Gab3 TTC TTCCTC X: 75,000,004 probably benign Het
Gimd1 T A 3: 132,634,900 M59K probably benign Het
Gm3667 T C 14: 6,873,057 Y139C probably damaging Het
Gng2 T A 14: 19,891,403 probably null Het
Gpr162 A G 6: 124,859,607 I367T probably benign Het
Hacd4 A G 4: 88,437,458 probably null Het
Hmcn1 C T 1: 150,657,118 V3105M probably benign Het
Iws1 T C 18: 32,083,320 V371A probably benign Het
Kctd10 C T 5: 114,370,171 R92Q probably damaging Het
Lepr T C 4: 101,774,221 F643L possibly damaging Het
Lpgat1 T C 1: 191,719,457 V65A possibly damaging Het
Lrrk2 C T 15: 91,673,256 probably benign Het
Magel2 A G 7: 62,380,549 D1067G unknown Het
Nol10 T A 12: 17,416,198 D531E probably benign Het
Odf2 T A 2: 29,893,496 V103D probably damaging Het
Olfr1303 T A 2: 111,813,851 K292* probably null Het
Pcdhb21 A G 18: 37,515,018 Y400C probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkn2 C T 3: 142,809,488 R695Q probably benign Het
Pld3 A G 7: 27,532,664 V397A probably benign Het
Ppp1r9a A G 6: 4,906,012 D189G probably damaging Het
Ppp2r1b A G 9: 50,866,556 K267R probably benign Het
Prkca A G 11: 108,014,235 S226P probably benign Het
Ptpru T C 4: 131,772,532 N1267S probably damaging Het
Pxn T A 5: 115,548,621 C391S probably benign Het
Rars T C 11: 35,827,429 E136G probably benign Het
Rrp12 A T 19: 41,890,138 D189E probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sdc1 T C 12: 8,791,665 L265P probably damaging Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Tasp1 A T 2: 139,883,770 probably null Het
Telo2 T C 17: 25,105,092 T550A probably benign Het
Tmem131l A T 3: 83,942,815 N225K probably damaging Het
Tmem260 T A 14: 48,520,346 V706D unknown Het
Tnr T A 1: 159,850,234 M63K probably benign Het
Ttn A G 2: 76,742,069 I26160T probably damaging Het
Ubap1 T C 4: 41,379,872 probably null Het
Ush2a C T 1: 188,466,136 P1466S probably benign Het
Usp24 T G 4: 106,397,311 M1495R probably benign Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn1r16 A T 6: 57,323,265 I124N probably benign Het
Vmn1r181 A G 7: 23,985,019 N303S probably benign Het
Vmn1r50 G A 6: 90,108,040 V256I probably benign Het
Vps54 A G 11: 21,277,913 N288S possibly damaging Het
Zfp266 A T 9: 20,505,144 F50Y probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7422:Mrc2 UTSW 11 105292783 start gained probably benign
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
R7885:Mrc2 UTSW 11 105332266 missense probably damaging 0.98
R7976:Mrc2 UTSW 11 105348003 missense possibly damaging 0.74
R8042:Mrc2 UTSW 11 105348355 missense probably damaging 0.98
R8096:Mrc2 UTSW 11 105343507 missense probably damaging 1.00
R8353:Mrc2 UTSW 11 105332311 missense probably damaging 0.98
R8453:Mrc2 UTSW 11 105332311 missense probably damaging 0.98
R8519:Mrc2 UTSW 11 105347306 missense possibly damaging 0.62
R8771:Mrc2 UTSW 11 105349770 missense probably benign
R8787:Mrc2 UTSW 11 105347639 missense probably benign
R8925:Mrc2 UTSW 11 105325508 missense probably benign 0.00
R8927:Mrc2 UTSW 11 105325508 missense probably benign 0.00
R8991:Mrc2 UTSW 11 105338914 missense probably benign
R9017:Mrc2 UTSW 11 105325885 missense probably damaging 1.00
R9097:Mrc2 UTSW 11 105340572 missense probably damaging 1.00
R9223:Mrc2 UTSW 11 105329267 missense probably damaging 1.00
R9471:Mrc2 UTSW 11 105343733 missense probably benign 0.03
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Z1176:Mrc2 UTSW 11 105341376 missense possibly damaging 0.94
Z1176:Mrc2 UTSW 11 105347360 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGATTGGCCTGAACCGC -3'
(R):5'- CCCCAAATTCCTTGCTTCAAAG -3'

Sequencing Primer
(F):5'- TATAGCAGGGCCTGACACG -3'
(R):5'- AAAGCCCTTGTCTAGCATCTG -3'
Posted On 2021-12-30