Incidental Mutation 'R9096:Tmem260'
ID 691379
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9096 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48520346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 706 (V706D)
Ref Sequence ENSEMBL: ENSMUSP00000154083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000226422] [ENSMUST00000227440]
AlphaFold Q8BMD6
Predicted Effect probably benign
Transcript: ENSMUST00000111735
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226422
AA Change: V706D
Predicted Effect unknown
Transcript: ENSMUST00000227440
AA Change: V623D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,191,927 V73E Het
Abhd12b T A 12: 70,163,433 Y128N probably damaging Het
Arhgap40 A T 2: 158,547,664 M586L probably benign Het
Armt1 T C 10: 4,434,829 S15P probably damaging Het
Arnt G T 3: 95,490,277 S535I probably benign Het
Bmper T C 9: 23,223,692 S18P possibly damaging Het
Catsperg1 G C 7: 29,184,727 T987R probably damaging Het
Col9a1 A T 1: 24,185,126 I130F unknown Het
Dennd1a G T 2: 37,800,065 L1008I probably damaging Het
Depdc1a T A 3: 159,498,480 D55E probably benign Het
Dlc1 A T 8: 36,613,567 I10N probably benign Het
Dnah1 T A 14: 31,261,070 I4203F probably damaging Het
Dzank1 G T 2: 144,474,962 L767I possibly damaging Het
Eprs C A 1: 185,407,106 A896E probably benign Het
Fryl T C 5: 73,108,577 D467G probably benign Het
Gab3 TTC TTCCTC X: 75,000,004 probably benign Het
Gimd1 T A 3: 132,634,900 M59K probably benign Het
Gm3667 T C 14: 6,873,057 Y139C probably damaging Het
Gng2 T A 14: 19,891,403 probably null Het
Gpr162 A G 6: 124,859,607 I367T probably benign Het
Hacd4 A G 4: 88,437,458 probably null Het
Hmcn1 C T 1: 150,657,118 V3105M probably benign Het
Iws1 T C 18: 32,083,320 V371A probably benign Het
Kctd10 C T 5: 114,370,171 R92Q probably damaging Het
Lepr T C 4: 101,774,221 F643L possibly damaging Het
Lpgat1 T C 1: 191,719,457 V65A possibly damaging Het
Lrrk2 C T 15: 91,673,256 probably benign Het
Magel2 A G 7: 62,380,549 D1067G unknown Het
Mrc2 A G 11: 105,340,572 D777G probably damaging Het
Nol10 T A 12: 17,416,198 D531E probably benign Het
Odf2 T A 2: 29,893,496 V103D probably damaging Het
Olfr1303 T A 2: 111,813,851 K292* probably null Het
Pcdhb21 A G 18: 37,515,018 Y400C probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkn2 C T 3: 142,809,488 R695Q probably benign Het
Pld3 A G 7: 27,532,664 V397A probably benign Het
Ppp1r9a A G 6: 4,906,012 D189G probably damaging Het
Ppp2r1b A G 9: 50,866,556 K267R probably benign Het
Prkca A G 11: 108,014,235 S226P probably benign Het
Ptpru T C 4: 131,772,532 N1267S probably damaging Het
Pxn T A 5: 115,548,621 C391S probably benign Het
Rars T C 11: 35,827,429 E136G probably benign Het
Rrp12 A T 19: 41,890,138 D189E probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sdc1 T C 12: 8,791,665 L265P probably damaging Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Tasp1 A T 2: 139,883,770 probably null Het
Telo2 T C 17: 25,105,092 T550A probably benign Het
Tmem131l A T 3: 83,942,815 N225K probably damaging Het
Tnr T A 1: 159,850,234 M63K probably benign Het
Ttn A G 2: 76,742,069 I26160T probably damaging Het
Ubap1 T C 4: 41,379,872 probably null Het
Ush2a C T 1: 188,466,136 P1466S probably benign Het
Usp24 T G 4: 106,397,311 M1495R probably benign Het
Utp20 T C 10: 88,775,318 N1379S probably damaging Het
Vmn1r16 A T 6: 57,323,265 I124N probably benign Het
Vmn1r181 A G 7: 23,985,019 N303S probably benign Het
Vmn1r50 G A 6: 90,108,040 V256I probably benign Het
Vps54 A G 11: 21,277,913 N288S possibly damaging Het
Zfp266 A T 9: 20,505,144 F50Y probably damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9056:Tmem260 UTSW 14 48480317 missense probably benign
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAAAGCCTGTGGGTTGCC -3'
(R):5'- CAGACTGTGAACTGGAGAGC -3'

Sequencing Primer
(F):5'- TTAATAGTGCACTTAAGCCGGGC -3'
(R):5'- AGAGCTGGGAGGGATTCGATTTC -3'
Posted On 2021-12-30