Incidental Mutation 'R9097:Igf2r'
ID 691437
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock # R9097 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12691213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 2043 (A2043D)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: A2043D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: A2043D

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl G A 14: 34,071,703 V463I probably benign Het
Aox2 T A 1: 58,287,728 L162Q possibly damaging Het
Arhgap40 A T 2: 158,547,664 M586L probably benign Het
Arnt G T 3: 95,490,277 S535I probably benign Het
Bsx G T 9: 40,874,340 G55C probably damaging Het
Col9a1 A T 1: 24,185,126 I130F unknown Het
Cyp51 G T 5: 4,099,172 T235N possibly damaging Het
Depdc1a T A 3: 159,498,480 D55E probably benign Het
Dlc1 A T 8: 36,613,567 I10N probably benign Het
Dzank1 G T 2: 144,474,962 L767I possibly damaging Het
Eif3k A T 7: 28,972,235 *193K probably null Het
Eprs C A 1: 185,407,106 A896E probably benign Het
Evc2 T A 5: 37,393,161 F840I possibly damaging Het
Fut2 G T 7: 45,650,951 H132Q probably benign Het
Gbp11 T C 5: 105,326,481 *443W probably null Het
Gimd1 T A 3: 132,634,900 M59K probably benign Het
Glis2 A G 16: 4,611,776 T228A probably damaging Het
Gm21663 G C 5: 25,942,169 C46W probably benign Het
Gm8251 T C 1: 44,058,889 I1016M possibly damaging Het
Gpr162 A G 6: 124,859,607 I367T probably benign Het
Grik1 G A 16: 87,935,908 T692I Het
Il12b C A 11: 44,410,280 L208M probably benign Het
Il12b T A 11: 44,410,281 L208Q probably damaging Het
Lrrk2 C T 15: 91,673,256 probably benign Het
Map3k9 T C 12: 81,773,081 D133G possibly damaging Het
Mrc2 A G 11: 105,340,572 D777G probably damaging Het
Mtrr A G 13: 68,575,322 L157P probably benign Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Nsmaf CAAACTTTTAAACTT CAAACTT 4: 6,416,543 probably null Het
Olfr1014 T A 2: 85,777,325 V247E probably damaging Het
Olfr1303 T A 2: 111,813,851 K292* probably null Het
Olfr498 A T 7: 108,465,608 I95F probably damaging Het
Olfr562-ps1 A G 7: 102,782,268 H264R probably damaging Het
Olfr789 T A 10: 129,487,778 M256K possibly damaging Het
Olfr837 G A 9: 19,137,374 C127Y probably damaging Het
Pkn2 C T 3: 142,809,488 R695Q probably benign Het
Ppp1r9a A G 6: 4,906,012 D189G probably damaging Het
Prkca A G 11: 108,014,235 S226P probably benign Het
Ptpru T C 4: 131,772,532 N1267S probably damaging Het
Retnlb T A 16: 48,818,617 probably benign Het
Rrp12 A T 19: 41,890,138 D189E probably benign Het
Serpinb7 G A 1: 107,450,177 C200Y probably damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Stk32a A T 18: 43,313,432 M316L possibly damaging Het
Supt6 G T 11: 78,222,274 H948N probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Tasp1 A T 2: 139,883,770 probably null Het
Telo2 T C 17: 25,105,092 T550A probably benign Het
Tmem131l A T 3: 83,942,815 N225K probably damaging Het
Tnc T C 4: 63,970,385 T1724A possibly damaging Het
Tyk2 C A 9: 21,108,776 E1029* probably null Het
Uhmk1 C T 1: 170,215,310 probably benign Het
Vav2 G A 2: 27,291,838 R330W probably damaging Het
Vmn1r16 A T 6: 57,323,265 I124N probably benign Het
Vmn1r181 A G 7: 23,985,019 N303S probably benign Het
Vmn1r50 G A 6: 90,108,040 V256I probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
outlier UTSW 17 12695314 missense probably benign 0.20
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8500:Igf2r UTSW 17 12709441 missense probably damaging 0.99
R8510:Igf2r UTSW 17 12704313 missense probably benign 0.38
R8933:Igf2r UTSW 17 12701244 missense probably damaging 0.97
R8933:Igf2r UTSW 17 12704637 missense probably damaging 1.00
R8976:Igf2r UTSW 17 12726772 missense probably damaging 1.00
R8994:Igf2r UTSW 17 12716650 missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12751293 start codon destroyed probably null
R9127:Igf2r UTSW 17 12739351 missense probably damaging 0.98
R9278:Igf2r UTSW 17 12695353 missense probably damaging 1.00
R9362:Igf2r UTSW 17 12722175 missense probably benign 0.02
R9371:Igf2r UTSW 17 12705759 missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12698328 missense probably benign 0.26
R9567:Igf2r UTSW 17 12686754 missense probably damaging 1.00
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCGGGTTTCCACCAAAG -3'
(R):5'- TCAGCTACTCTGTATGGCTGC -3'

Sequencing Primer
(F):5'- GGTTTCCACCAAAGCTCAGG -3'
(R):5'- TCAGGGAGTCAGTTACCTTCCAAG -3'
Posted On 2021-12-30