Mutagenetix > Incidental Mutation

Incidental Mutation 'R9097:Igf2r'

691437

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR

MMRRC Submission

068912-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R9097 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12901293-12988551 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 12910100 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 2043 (A2043D)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: A2043D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: A2043D

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Antxrl	G	A	14: 33,793,660 (GRCm39)	V463I	probably benign	Het
Aox1	T	A	1: 58,326,887 (GRCm39)	L162Q	possibly damaging	Het
Arhgap40	A	T	2: 158,389,584 (GRCm39)	M586L	probably benign	Het
Arnt	G	T	3: 95,397,588 (GRCm39)	S535I	probably benign	Het
Bsx	G	T	9: 40,785,636 (GRCm39)	G55C	probably damaging	Het
Ccdc168	T	C	1: 44,098,049 (GRCm39)	I1016M	possibly damaging	Het
Col9a1	A	T	1: 24,224,207 (GRCm39)	I130F	unknown	Het
Cyp51	G	T	5: 4,149,172 (GRCm39)	T235N	possibly damaging	Het
Depdc1a	T	A	3: 159,204,117 (GRCm39)	D55E	probably benign	Het
Dlc1	A	T	8: 37,080,721 (GRCm39)	I10N	probably benign	Het
Dzank1	G	T	2: 144,316,882 (GRCm39)	L767I	possibly damaging	Het
Eif3k	A	T	7: 28,671,660 (GRCm39)	*193K	probably null	Het
Eprs1	C	A	1: 185,139,303 (GRCm39)	A896E	probably benign	Het
Evc2	T	A	5: 37,550,505 (GRCm39)	F840I	possibly damaging	Het
Fut2	G	T	7: 45,300,375 (GRCm39)	H132Q	probably benign	Het
Gbp11	T	C	5: 105,474,347 (GRCm39)	*443W	probably null	Het
Gimd1	T	A	3: 132,340,661 (GRCm39)	M59K	probably benign	Het
Glis2	A	G	16: 4,429,640 (GRCm39)	T228A	probably damaging	Het
Gm21663	G	C	5: 26,147,167 (GRCm39)	C46W	probably benign	Het
Gpr162	A	G	6: 124,836,570 (GRCm39)	I367T	probably benign	Het
Grik1	G	A	16: 87,732,796 (GRCm39)	T692I		Het
Il12b	C	A	11: 44,301,107 (GRCm39)	L208M	probably benign	Het
Il12b	T	A	11: 44,301,108 (GRCm39)	L208Q	probably damaging	Het
Lrrk2	C	T	15: 91,557,459 (GRCm39)		probably benign	Het
Map3k9	T	C	12: 81,819,855 (GRCm39)	D133G	possibly damaging	Het
Mrc2	A	G	11: 105,231,398 (GRCm39)	D777G	probably damaging	Het
Mtrr	A	G	13: 68,723,441 (GRCm39)	L157P	probably benign	Het
Nol4l	C	A	2: 153,312,630 (GRCm39)	R226L	probably damaging	Het
Nsmaf	CAAACTTTTAAACTT	CAAACTT	4: 6,416,543 (GRCm39)		probably null	Het
Or4f7	T	A	2: 111,644,196 (GRCm39)	K292*	probably null	Het
Or51f23c-ps1	A	G	7: 102,431,475 (GRCm39)	H264R	probably damaging	Het
Or5p73	A	T	7: 108,064,815 (GRCm39)	I95F	probably damaging	Het
Or6c7	T	A	10: 129,323,647 (GRCm39)	M256K	possibly damaging	Het
Or7g22	G	A	9: 19,048,670 (GRCm39)	C127Y	probably damaging	Het
Or9g8	T	A	2: 85,607,669 (GRCm39)	V247E	probably damaging	Het
Pkn2	C	T	3: 142,515,249 (GRCm39)	R695Q	probably benign	Het
Ppp1r9a	A	G	6: 4,906,012 (GRCm39)	D189G	probably damaging	Het
Prkca	A	G	11: 107,905,061 (GRCm39)	S226P	probably benign	Het
Ptpru	T	C	4: 131,499,843 (GRCm39)	N1267S	probably damaging	Het
Retnlb	T	A	16: 48,638,980 (GRCm39)		probably benign	Het
Rrp12	A	T	19: 41,878,577 (GRCm39)	D189E	probably benign	Het
Serpinb7	G	A	1: 107,377,907 (GRCm39)	C200Y	probably damaging	Het
Sez6	G	A	11: 77,865,121 (GRCm39)	E623K	possibly damaging	Het
Stk32a	A	T	18: 43,446,497 (GRCm39)	M316L	possibly damaging	Het
Supt6	G	T	11: 78,113,100 (GRCm39)	H948N	probably benign	Het
Sycp2l	A	T	13: 41,300,070 (GRCm39)	D428V	possibly damaging	Het
Tasp1	A	T	2: 139,725,690 (GRCm39)		probably null	Het
Telo2	T	C	17: 25,324,066 (GRCm39)	T550A	probably benign	Het
Tmem131l	A	T	3: 83,850,122 (GRCm39)	N225K	probably damaging	Het
Tnc	T	C	4: 63,888,622 (GRCm39)	T1724A	possibly damaging	Het
Tyk2	C	A	9: 21,020,072 (GRCm39)	E1029*	probably null	Het
Uhmk1	C	T	1: 170,042,879 (GRCm39)		probably benign	Het
Vav2	G	A	2: 27,181,850 (GRCm39)	R330W	probably damaging	Het
Vmn1r16	A	T	6: 57,300,250 (GRCm39)	I124N	probably benign	Het
Vmn1r181	A	G	7: 23,684,444 (GRCm39)	N303S	probably benign	Het
Vmn1r50	G	A	6: 90,085,022 (GRCm39)	V256I	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,932,877 (GRCm39)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,958,215 (GRCm39)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,919,245 (GRCm39)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,902,754 (GRCm39)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,923,662 (GRCm39)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,914,261 (GRCm39)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,923,236 (GRCm39)	missense	probably benign
IGL01557:Igf2r	APN	17	12,923,522 (GRCm39)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,902,872 (GRCm39)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,944,302 (GRCm39)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,920,200 (GRCm39)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,902,709 (GRCm39)	missense	probably benign
IGL01839:Igf2r	APN	17	12,923,909 (GRCm39)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,933,798 (GRCm39)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,923,225 (GRCm39)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,912,079 (GRCm39)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,920,892 (GRCm39)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,917,403 (GRCm39)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,967,650 (GRCm39)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,930,974 (GRCm39)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,938,770 (GRCm39)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,911,610 (GRCm39)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,913,007 (GRCm39)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,929,633 (GRCm39)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,945,563 (GRCm39)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,935,559 (GRCm39)	missense	probably damaging	1.00
blunt	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
brusque	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
gruff	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
outlier	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,910,849 (GRCm39)	missense	probably benign
R0165:Igf2r	UTSW	17	12,917,414 (GRCm39)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,902,835 (GRCm39)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,910,951 (GRCm39)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,936,161 (GRCm39)	splice site	probably null
R0722:Igf2r	UTSW	17	12,934,382 (GRCm39)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,910,988 (GRCm39)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,913,011 (GRCm39)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,936,156 (GRCm39)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,910,172 (GRCm39)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,945,196 (GRCm39)	missense	probably benign
R1693:Igf2r	UTSW	17	12,923,203 (GRCm39)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,916,328 (GRCm39)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,923,157 (GRCm39)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,952,790 (GRCm39)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,911,625 (GRCm39)	missense	probably benign
R2060:Igf2r	UTSW	17	12,920,206 (GRCm39)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,917,138 (GRCm39)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,941,095 (GRCm39)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,934,830 (GRCm39)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,941,198 (GRCm39)	splice site	probably null
R2696:Igf2r	UTSW	17	12,914,231 (GRCm39)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,928,355 (GRCm39)	missense	probably benign
R3930:Igf2r	UTSW	17	12,924,716 (GRCm39)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,967,638 (GRCm39)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,921,141 (GRCm39)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,922,352 (GRCm39)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,903,013 (GRCm39)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,920,240 (GRCm39)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,910,764 (GRCm39)	splice site	probably null
R4980:Igf2r	UTSW	17	12,922,247 (GRCm39)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,944,303 (GRCm39)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,912,032 (GRCm39)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,958,221 (GRCm39)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,936,254 (GRCm39)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,917,239 (GRCm39)	splice site	probably null
R5794:Igf2r	UTSW	17	12,928,332 (GRCm39)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,933,000 (GRCm39)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,902,787 (GRCm39)	missense	probably benign
R6396:Igf2r	UTSW	17	12,932,977 (GRCm39)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,920,137 (GRCm39)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,917,505 (GRCm39)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,933,831 (GRCm39)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,932,969 (GRCm39)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,922,263 (GRCm39)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,916,228 (GRCm39)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,937,605 (GRCm39)	missense	probably benign
R7030:Igf2r	UTSW	17	12,952,753 (GRCm39)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,917,212 (GRCm39)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,923,210 (GRCm39)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,933,003 (GRCm39)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,922,371 (GRCm39)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,917,115 (GRCm39)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,929,532 (GRCm39)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,917,160 (GRCm39)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,954,878 (GRCm39)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,958,256 (GRCm39)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,967,591 (GRCm39)	missense	probably benign
R8022:Igf2r	UTSW	17	12,937,682 (GRCm39)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,920,125 (GRCm39)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,910,958 (GRCm39)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,952,747 (GRCm39)	missense	probably benign
R8359:Igf2r	UTSW	17	12,902,748 (GRCm39)	missense	probably benign
R8500:Igf2r	UTSW	17	12,928,328 (GRCm39)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,923,200 (GRCm39)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,923,524 (GRCm39)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,920,131 (GRCm39)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,945,659 (GRCm39)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,935,537 (GRCm39)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,970,180 (GRCm39)	start codon destroyed	probably null
R9127:Igf2r	UTSW	17	12,958,238 (GRCm39)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,914,240 (GRCm39)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,924,646 (GRCm39)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,917,215 (GRCm39)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,905,641 (GRCm39)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,913,027 (GRCm39)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,945,588 (GRCm39)	missense	probably benign
X0028:Igf2r	UTSW	17	12,923,800 (GRCm39)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,916,286 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCACCGGGTTTCCACCAAAG -3'
(R):5'- TCAGCTACTCTGTATGGCTGC -3'

Sequencing Primer
(F):5'- GGTTTCCACCAAAGCTCAGG -3'
(R):5'- TCAGGGAGTCAGTTACCTTCCAAG -3'

Posted On

2021-12-30