Incidental Mutation 'R9098:Bsn'
ID 691489
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R9098 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108112974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1860 (P1860S)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035208
AA Change: P1860S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: P1860S

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik T C 6: 73,469,534 T11A probably benign Het
A830018L16Rik A T 1: 11,562,987 D168V probably damaging Het
Abcb4 A T 5: 8,958,441 D1203V probably damaging Het
Acat2 G A 17: 12,960,092 probably benign Het
Adam3 C T 8: 24,689,468 C611Y probably damaging Het
Adgrb1 A G 15: 74,543,340 D638G probably damaging Het
Adra1b T C 11: 43,776,391 N340D probably damaging Het
Ankrd31 A G 13: 96,780,371 H131R probably damaging Het
Aoc2 T C 11: 101,326,338 S416P possibly damaging Het
Armc8 G A 9: 99,505,309 R419* probably null Het
Atp6v1h T G 1: 5,093,415 V90G probably damaging Het
Avl9 T C 6: 56,730,643 V191A probably benign Het
Btd A G 14: 31,662,276 K73R probably benign Het
Cd22 T C 7: 30,867,966 K731R probably benign Het
Chmp7 C A 14: 69,719,462 L332F probably damaging Het
Cldn11 A G 3: 31,163,127 E148G probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cnbd1 A T 4: 18,886,061 Y319* probably null Het
Cnnm4 A G 1: 36,472,089 T133A probably benign Het
Cpeb4 A T 11: 31,872,679 E131V probably benign Het
Ctns A G 11: 73,187,735 probably null Het
Dhx36 C A 3: 62,506,720 E74* probably null Het
Dhx36 C A 3: 62,506,721 Q73H probably benign Het
Dnah5 A G 15: 28,419,961 T3802A Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Flnc C T 6: 29,455,519 Q2056* probably null Het
Fmo9 T C 1: 166,664,630 D408G possibly damaging Het
Gipr C T 7: 19,163,570 S117N unknown Het
Gm13088 A T 4: 143,654,527 Y309N probably benign Het
Gm14412 T A 2: 177,314,563 H513L probably damaging Het
Gm21663 G C 5: 25,942,169 C46W probably benign Het
Gm29776 T G 14: 54,695,229 S393R probably damaging Het
Gucy1a2 A T 9: 3,634,489 I178L probably benign Het
Htr1b A T 9: 81,632,428 L42Q Het
Htr2b T C 1: 86,099,759 T342A probably damaging Het
Jph2 C T 2: 163,339,553 V564M probably damaging Het
Kcnmb1 A G 11: 33,964,806 T36A probably damaging Het
Krit1 A C 5: 3,813,135 K310N probably benign Het
Lama1 C T 17: 67,804,513 T2253M Het
Lpar6 C T 14: 73,238,793 L65F probably damaging Het
Megf6 G A 4: 154,269,703 G1355R probably damaging Het
Mkl2 A G 16: 13,403,189 H743R probably benign Het
Mmp3 T A 9: 7,446,936 Y39N probably damaging Het
Ms4a18 C A 19: 11,013,377 V118F Het
Mthfr G A 4: 148,041,625 S51N probably benign Het
Muc16 T A 9: 18,643,679 T3773S unknown Het
Mus81 T A 19: 5,484,004 K400* probably null Het
Naaladl2 A T 3: 24,433,180 D192E probably benign Het
Naip5 T C 13: 100,229,619 D329G possibly damaging Het
Nek11 T A 9: 105,293,657 H393L probably benign Het
Nmt2 T A 2: 3,305,278 probably benign Het
Nmur2 T C 11: 56,029,582 D279G possibly damaging Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr961 A G 9: 39,647,083 D119G probably damaging Het
Olfr97 T C 17: 37,232,070 Y100C probably benign Het
Olfr992 T C 2: 85,399,651 N294S probably damaging Het
Palm A G 10: 79,819,154 T249A probably benign Het
Rhobtb3 A G 13: 75,939,583 I95T probably damaging Het
Rnpep A T 1: 135,278,821 F178L possibly damaging Het
Rsl1d1 A G 16: 11,201,363 S105P probably damaging Het
Rxra C T 2: 27,748,744 T253I possibly damaging Het
Schip1 A G 3: 68,064,985 D15G Het
Sis T A 3: 72,937,245 I719F possibly damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Srcap T C 7: 127,552,644 V2125A probably damaging Het
Stx7 C T 10: 24,182,826 Q199* probably null Het
Syt6 T C 3: 103,585,579 I134T probably damaging Het
Tlr12 A G 4: 128,617,077 M460T probably benign Het
Tnni3k T C 3: 154,941,677 T398A possibly damaging Het
Tspan4 T C 7: 141,491,903 S188P probably benign Het
Ubap2l A G 3: 90,002,449 S1025P unknown Het
Ubl7 A G 9: 57,921,752 D219G probably benign Het
Vmn2r115 C A 17: 23,345,829 T230K probably benign Het
Vmn2r95 T A 17: 18,439,905 M193K possibly damaging Het
Zfp639 A G 3: 32,519,736 E170G probably damaging Het
Zfy1 A G Y: 725,987 S593P possibly damaging Het
Zscan4-ps1 T A 7: 11,065,568 T465S probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9307:Bsn UTSW 9 108115794 missense probably benign 0.01
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108113601 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9563:Bsn UTSW 9 108107417 missense
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGTCACACTCTTGTCG -3'
(R):5'- GCTAAGTTTGCCAGGTATAACC -3'

Sequencing Primer
(F):5'- GTCACACTCTTGTCGGGTGC -3'
(R):5'- GGTATAACCTTCCCAACCAAGTAAC -3'
Posted On 2021-12-30