Mutagenetix > Incidental Mutation

Incidental Mutation 'R9098:Lama1'

691515

Institutional Source

Beutler Lab

Gene Symbol

Lama1

Ensembl Gene

ENSMUSG00000032796

Gene Name

laminin, alpha 1

Synonyms

Lama

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9098 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67697265-67822645 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67804513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 2253 (T2253M)

Ref Sequence

ENSEMBL: ENSMUSP00000043957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035471]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: T2253M

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
LamNT	23	275	1.2e-131	SMART
EGF_Lam	277	331	1e-5	SMART
EGF_Lam	334	401	6.6e-6	SMART
EGF_Lam	404	458	9.11e-9	SMART
EGF_Lam	461	507	8.12e-6	SMART
LamB	570	702	2.09e-57	SMART
EGF_like	715	746	3.36e0	SMART
EGF_Lam	749	795	7.01e-10	SMART
EGF_Lam	798	853	3.59e-7	SMART
EGF_Lam	856	906	1.53e-10	SMART
EGF_Lam	909	955	1.13e-13	SMART
EGF_Lam	958	1002	1.36e-7	SMART
EGF_Lam	1005	1048	7.29e-8	SMART
EGF_like	1034	1082	4.83e1	SMART
EGF_Lam	1051	1094	1.67e-7	SMART
EGF_Lam	1097	1154	1.32e-5	SMART
LamB	1220	1352	8.7e-46	SMART
Pfam:Laminin_EGF	1367	1397	1.7e-6	PFAM
EGF_Lam	1410	1456	7.12e-11	SMART
EGF_Lam	1459	1513	3.25e-5	SMART
EGF_like	1497	1547	6.41e1	SMART
EGF_Lam	1516	1560	1.71e-13	SMART
Pfam:Laminin_I	1574	1838	1.7e-91	PFAM
low complexity region	2012	2031	N/A	INTRINSIC
low complexity region	2087	2098	N/A	INTRINSIC
LamG	2145	2287	3.66e-30	SMART
LamG	2332	2473	5.98e-35	SMART
LamG	2513	2661	1.11e-29	SMART
low complexity region	2695	2708	N/A	INTRINSIC
LamG	2743	2877	9.72e-35	SMART
LamG	2920	3056	4.63e-41	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931417E11Rik	T	C	6: 73,469,534	T11A	probably benign	Het
A830018L16Rik	A	T	1: 11,562,987	D168V	probably damaging	Het
Abcb4	A	T	5: 8,958,441	D1203V	probably damaging	Het
Acat2	G	A	17: 12,960,092		probably benign	Het
Adam3	C	T	8: 24,689,468	C611Y	probably damaging	Het
Adgrb1	A	G	15: 74,543,340	D638G	probably damaging	Het
Adra1b	T	C	11: 43,776,391	N340D	probably damaging	Het
Ankrd31	A	G	13: 96,780,371	H131R	probably damaging	Het
Aoc2	T	C	11: 101,326,338	S416P	possibly damaging	Het
Armc8	G	A	9: 99,505,309	R419*	probably null	Het
Atp6v1h	T	G	1: 5,093,415	V90G	probably damaging	Het
Avl9	T	C	6: 56,730,643	V191A	probably benign	Het
Bsn	G	A	9: 108,112,974	P1860S	possibly damaging	Het
Btd	A	G	14: 31,662,276	K73R	probably benign	Het
Cd22	T	C	7: 30,867,966	K731R	probably benign	Het
Chmp7	C	A	14: 69,719,462	L332F	probably damaging	Het
Cldn11	A	G	3: 31,163,127	E148G	probably damaging	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
Cnbd1	A	T	4: 18,886,061	Y319*	probably null	Het
Cnnm4	A	G	1: 36,472,089	T133A	probably benign	Het
Cpeb4	A	T	11: 31,872,679	E131V	probably benign	Het
Ctns	A	G	11: 73,187,735		probably null	Het
Dhx36	C	A	3: 62,506,720	E74*	probably null	Het
Dhx36	C	A	3: 62,506,721	Q73H	probably benign	Het
Dnah5	A	G	15: 28,419,961	T3802A		Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Flnc	C	T	6: 29,455,519	Q2056*	probably null	Het
Fmo9	T	C	1: 166,664,630	D408G	possibly damaging	Het
Gipr	C	T	7: 19,163,570	S117N	unknown	Het
Gm13088	A	T	4: 143,654,527	Y309N	probably benign	Het
Gm14412	T	A	2: 177,314,563	H513L	probably damaging	Het
Gm21663	G	C	5: 25,942,169	C46W	probably benign	Het
Gm29776	T	G	14: 54,695,229	S393R	probably damaging	Het
Gucy1a2	A	T	9: 3,634,489	I178L	probably benign	Het
Htr1b	A	T	9: 81,632,428	L42Q		Het
Htr2b	T	C	1: 86,099,759	T342A	probably damaging	Het
Jph2	C	T	2: 163,339,553	V564M	probably damaging	Het
Kcnmb1	A	G	11: 33,964,806	T36A	probably damaging	Het
Krit1	A	C	5: 3,813,135	K310N	probably benign	Het
Lpar6	C	T	14: 73,238,793	L65F	probably damaging	Het
Megf6	G	A	4: 154,269,703	G1355R	probably damaging	Het
Mkl2	A	G	16: 13,403,189	H743R	probably benign	Het
Mmp3	T	A	9: 7,446,936	Y39N	probably damaging	Het
Ms4a18	C	A	19: 11,013,377	V118F		Het
Mthfr	G	A	4: 148,041,625	S51N	probably benign	Het
Muc16	T	A	9: 18,643,679	T3773S	unknown	Het
Mus81	T	A	19: 5,484,004	K400*	probably null	Het
Naaladl2	A	T	3: 24,433,180	D192E	probably benign	Het
Naip5	T	C	13: 100,229,619	D329G	possibly damaging	Het
Nek11	T	A	9: 105,293,657	H393L	probably benign	Het
Nmt2	T	A	2: 3,305,278		probably benign	Het
Nmur2	T	C	11: 56,029,582	D279G	possibly damaging	Het
Nol4l	C	A	2: 153,470,710	R226L	probably damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr961	A	G	9: 39,647,083	D119G	probably damaging	Het
Olfr97	T	C	17: 37,232,070	Y100C	probably benign	Het
Olfr992	T	C	2: 85,399,651	N294S	probably damaging	Het
Palm	A	G	10: 79,819,154	T249A	probably benign	Het
Rhobtb3	A	G	13: 75,939,583	I95T	probably damaging	Het
Rnpep	A	T	1: 135,278,821	F178L	possibly damaging	Het
Rsl1d1	A	G	16: 11,201,363	S105P	probably damaging	Het
Rxra	C	T	2: 27,748,744	T253I	possibly damaging	Het
Schip1	A	G	3: 68,064,985	D15G		Het
Sis	T	A	3: 72,937,245	I719F	possibly damaging	Het
Snx18	A	G	13: 113,617,774	S208P	probably benign	Het
Srcap	T	C	7: 127,552,644	V2125A	probably damaging	Het
Stx7	C	T	10: 24,182,826	Q199*	probably null	Het
Syt6	T	C	3: 103,585,579	I134T	probably damaging	Het
Tlr12	A	G	4: 128,617,077	M460T	probably benign	Het
Tnni3k	T	C	3: 154,941,677	T398A	possibly damaging	Het
Tspan4	T	C	7: 141,491,903	S188P	probably benign	Het
Ubap2l	A	G	3: 90,002,449	S1025P	unknown	Het
Ubl7	A	G	9: 57,921,752	D219G	probably benign	Het
Vmn2r115	C	A	17: 23,345,829	T230K	probably benign	Het
Vmn2r95	T	A	17: 18,439,905	M193K	possibly damaging	Het
Zfp639	A	G	3: 32,519,736	E170G	probably damaging	Het
Zfy1	A	G	Y: 725,987	S593P	possibly damaging	Het
Zscan4-ps1	T	A	7: 11,065,568	T465S	probably damaging	Het

Other mutations in Lama1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Lama1	APN	17	67815928	missense	probably benign
IGL00336:Lama1	APN	17	67813948	missense	probably benign	0.07
IGL01066:Lama1	APN	17	67743326	missense	probably damaging	1.00
IGL01140:Lama1	APN	17	67802933	missense	probably benign	0.14
IGL01291:Lama1	APN	17	67738870	missense	probably damaging	1.00
IGL01296:Lama1	APN	17	67745051	missense	probably benign	0.27
IGL01317:Lama1	APN	17	67818701	missense	probably damaging	1.00
IGL01490:Lama1	APN	17	67750584	missense	possibly damaging	0.54
IGL01506:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01508:Lama1	APN	17	67809361	splice site	probably benign
IGL01522:Lama1	APN	17	67752774	splice site	probably benign
IGL01530:Lama1	APN	17	67796790	missense	probably benign	0.02
IGL01541:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01677:Lama1	APN	17	67779148	missense	probably benign	0.15
IGL01886:Lama1	APN	17	67807797	missense	probably benign	0.36
IGL01994:Lama1	APN	17	67752439	missense	probably benign	0.05
IGL02017:Lama1	APN	17	67764725	missense	probably benign	0.00
IGL02021:Lama1	APN	17	67821626	missense	probably damaging	1.00
IGL02026:Lama1	APN	17	67809292	missense	possibly damaging	0.82
IGL02044:Lama1	APN	17	67811490	missense	probably benign	0.01
IGL02120:Lama1	APN	17	67716789	missense	probably damaging	1.00
IGL02425:Lama1	APN	17	67811485	missense	probably benign	0.45
IGL02549:Lama1	APN	17	67790835	missense	possibly damaging	0.93
IGL02642:Lama1	APN	17	67812366	missense	probably benign	0.00
IGL02795:Lama1	APN	17	67738894	splice site	probably null
IGL02798:Lama1	APN	17	67795191	splice site	probably benign
IGL02863:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02870:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02876:Lama1	APN	17	67750692	critical splice donor site	probably null
IGL02885:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02891:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02978:Lama1	APN	17	67786081	nonsense	probably null
IGL03064:Lama1	APN	17	67779104	missense	probably benign	0.01
IGL03076:Lama1	APN	17	67716799	missense	possibly damaging	0.95
IGL03110:Lama1	APN	17	67798986	missense	probably benign	0.04
IGL03143:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03159:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03268:Lama1	APN	17	67804536	missense	probably damaging	0.99
ANU05:Lama1	UTSW	17	67738870	missense	probably damaging	1.00
PIT4472001:Lama1	UTSW	17	67764704	missense
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0050:Lama1	UTSW	17	67782056	missense	possibly damaging	0.66
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0111:Lama1	UTSW	17	67737498	missense	probably damaging	0.98
R0116:Lama1	UTSW	17	67776923	missense	probably benign	0.10
R0121:Lama1	UTSW	17	67798513	splice site	probably benign
R0278:Lama1	UTSW	17	67810183	missense	probably null	0.98
R0281:Lama1	UTSW	17	67817569	missense	probably damaging	1.00
R0312:Lama1	UTSW	17	67775851	missense	possibly damaging	0.45
R0419:Lama1	UTSW	17	67791610	critical splice donor site	probably null
R0512:Lama1	UTSW	17	67779134	missense	possibly damaging	0.67
R0514:Lama1	UTSW	17	67764698	missense	probably benign	0.40
R0562:Lama1	UTSW	17	67815959	missense	probably damaging	1.00
R0632:Lama1	UTSW	17	67752368	splice site	probably benign
R0645:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R0712:Lama1	UTSW	17	67779042	splice site	probably null
R0763:Lama1	UTSW	17	67772818	missense	probably damaging	0.97
R0941:Lama1	UTSW	17	67775865	missense	probably benign	0.10
R1025:Lama1	UTSW	17	67752898	missense	probably benign	0.00
R1084:Lama1	UTSW	17	67804469	missense	probably benign	0.12
R1103:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1420:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1430:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R1569:Lama1	UTSW	17	67780618	splice site	probably null
R1575:Lama1	UTSW	17	67810409	missense	possibly damaging	0.96
R1613:Lama1	UTSW	17	67807923	missense	probably benign	0.42
R1620:Lama1	UTSW	17	67767033	missense	probably benign	0.01
R1629:Lama1	UTSW	17	67805428	missense	probably benign	0.00
R1645:Lama1	UTSW	17	67737682	missense	probably benign	0.14
R1652:Lama1	UTSW	17	67807846	missense	probably damaging	0.97
R1674:Lama1	UTSW	17	67791244	missense	probably benign
R1678:Lama1	UTSW	17	67810155	missense	possibly damaging	0.56
R1710:Lama1	UTSW	17	67753791	missense	probably benign	0.00
R1712:Lama1	UTSW	17	67717186	missense	possibly damaging	0.95
R1737:Lama1	UTSW	17	67802921	missense	probably benign	0.36
R1757:Lama1	UTSW	17	67763836	missense	probably benign	0.40
R1757:Lama1	UTSW	17	67697383	missense	unknown
R1813:Lama1	UTSW	17	67791223	missense	probably benign
R1896:Lama1	UTSW	17	67791223	missense	probably benign
R1945:Lama1	UTSW	17	67745853	missense	probably benign	0.14
R2086:Lama1	UTSW	17	67817623	missense	probably damaging	1.00
R2149:Lama1	UTSW	17	67773865	missense	possibly damaging	0.95
R2178:Lama1	UTSW	17	67769515	missense	probably benign	0.07
R2183:Lama1	UTSW	17	67791009	missense	probably damaging	0.98
R2197:Lama1	UTSW	17	67752941	missense	probably benign	0.02
R2213:Lama1	UTSW	17	67777034	nonsense	probably null
R2260:Lama1	UTSW	17	67737507	missense	probably damaging	0.96
R2356:Lama1	UTSW	17	67810114	missense	probably damaging	1.00
R2420:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2421:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2422:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2424:Lama1	UTSW	17	67798665	missense	probably benign	0.09
R2442:Lama1	UTSW	17	67768317	missense	probably benign	0.04
R3147:Lama1	UTSW	17	67737658	missense	probably damaging	0.98
R3414:Lama1	UTSW	17	67737603	missense	probably damaging	1.00
R3683:Lama1	UTSW	17	67768333	missense	probably benign	0.40
R3820:Lama1	UTSW	17	67779046	splice site	probably null
R3821:Lama1	UTSW	17	67779046	splice site	probably null
R3822:Lama1	UTSW	17	67779046	splice site	probably null
R4012:Lama1	UTSW	17	67812373	nonsense	probably null
R4113:Lama1	UTSW	17	67764703	missense	probably benign	0.01
R4133:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R4133:Lama1	UTSW	17	67812486	missense	probably damaging	1.00
R4259:Lama1	UTSW	17	67752418	missense	possibly damaging	0.95
R4278:Lama1	UTSW	17	67791517	missense	probably null	0.00
R4321:Lama1	UTSW	17	67771083	missense	probably benign	0.03
R4374:Lama1	UTSW	17	67804518	missense	probably benign	0.00
R4386:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R4463:Lama1	UTSW	17	67761700	missense	probably damaging	1.00
R4629:Lama1	UTSW	17	67805360	critical splice acceptor site	probably null
R4630:Lama1	UTSW	17	67794300	missense	probably benign	0.00
R4633:Lama1	UTSW	17	67798584	missense	probably damaging	0.96
R4668:Lama1	UTSW	17	67752434	missense	probably benign	0.27
R4684:Lama1	UTSW	17	67773778	missense	possibly damaging	0.88
R4745:Lama1	UTSW	17	67738780	missense	probably damaging	1.00
R4786:Lama1	UTSW	17	67773859	missense	possibly damaging	0.77
R4797:Lama1	UTSW	17	67716775	missense	probably benign	0.04
R4803:Lama1	UTSW	17	67809271	missense	probably damaging	1.00
R4925:Lama1	UTSW	17	67794314	missense	probably benign	0.02
R4939:Lama1	UTSW	17	67737475	missense	possibly damaging	0.91
R4952:Lama1	UTSW	17	67767566	critical splice donor site	probably null
R4975:Lama1	UTSW	17	67738834	missense	possibly damaging	0.95
R4977:Lama1	UTSW	17	67737682	missense	probably damaging	1.00
R5039:Lama1	UTSW	17	67745893	missense	possibly damaging	0.66
R5047:Lama1	UTSW	17	67743281	nonsense	probably null
R5195:Lama1	UTSW	17	67764800	missense	probably benign	0.13
R5230:Lama1	UTSW	17	67745083	nonsense	probably null
R5236:Lama1	UTSW	17	67804492	missense	probably benign	0.24
R5254:Lama1	UTSW	17	67756716	missense	probably benign	0.01
R5345:Lama1	UTSW	17	67817563	missense	probably benign
R5438:Lama1	UTSW	17	67800774	missense	possibly damaging	0.92
R5521:Lama1	UTSW	17	67780894	nonsense	probably null
R5568:Lama1	UTSW	17	67768298	critical splice acceptor site	probably null
R5645:Lama1	UTSW	17	67802948	missense	probably damaging	1.00
R5665:Lama1	UTSW	17	67770987	missense	probably damaging	1.00
R5727:Lama1	UTSW	17	67815224	missense	possibly damaging	0.81
R5757:Lama1	UTSW	17	67738787	missense	possibly damaging	0.59
R5795:Lama1	UTSW	17	67796727	missense	probably benign	0.02
R5857:Lama1	UTSW	17	67807843	missense	probably damaging	0.99
R5894:Lama1	UTSW	17	67779047	critical splice acceptor site	probably null
R5974:Lama1	UTSW	17	67773727	missense	probably benign	0.31
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6120:Lama1	UTSW	17	67780617	critical splice donor site	probably null
R6219:Lama1	UTSW	17	67790856	missense	probably benign	0.08
R6224:Lama1	UTSW	17	67802987	missense	possibly damaging	0.56
R6249:Lama1	UTSW	17	67798604	missense	probably benign
R6265:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R6276:Lama1	UTSW	17	67784088	splice site	probably null
R6284:Lama1	UTSW	17	67810096	missense	probably damaging	0.99
R6337:Lama1	UTSW	17	67786019	missense	probably benign	0.27
R6414:Lama1	UTSW	17	67746910	critical splice donor site	probably null
R6631:Lama1	UTSW	17	67774482	missense	probably benign	0.21
R6659:Lama1	UTSW	17	67818635	missense	probably damaging	1.00
R6660:Lama1	UTSW	17	67804500	missense	probably benign	0.05
R6677:Lama1	UTSW	17	67795233	missense	probably benign	0.14
R6763:Lama1	UTSW	17	67746873	missense	unknown
R6787:Lama1	UTSW	17	67784025	missense	unknown
R6831:Lama1	UTSW	17	67756754	missense	possibly damaging	0.89
R6855:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R6910:Lama1	UTSW	17	67791464	missense	possibly damaging	0.60
R6934:Lama1	UTSW	17	67774543	missense	probably benign	0.04
R6945:Lama1	UTSW	17	67813866	missense
R6984:Lama1	UTSW	17	67779112	missense
R6989:Lama1	UTSW	17	67753758	missense
R6994:Lama1	UTSW	17	67753825	missense
R6995:Lama1	UTSW	17	67753825	missense
R7035:Lama1	UTSW	17	67781049	missense
R7133:Lama1	UTSW	17	67782146	missense
R7172:Lama1	UTSW	17	67804545	missense
R7197:Lama1	UTSW	17	67737705	nonsense	probably null
R7217:Lama1	UTSW	17	67764673	missense
R7229:Lama1	UTSW	17	67752446	missense
R7264:Lama1	UTSW	17	67743297	missense
R7311:Lama1	UTSW	17	67767385	missense
R7394:Lama1	UTSW	17	67717261	missense
R7419:Lama1	UTSW	17	67717174	missense
R7460:Lama1	UTSW	17	67767018	missense
R7492:Lama1	UTSW	17	67817651	missense
R7494:Lama1	UTSW	17	67811446	missense
R7552:Lama1	UTSW	17	67737667	missense
R7576:Lama1	UTSW	17	67782041	missense
R7583:Lama1	UTSW	17	67761621	missense
R7649:Lama1	UTSW	17	67737554	missense
R7663:Lama1	UTSW	17	67780880	missense
R7667:Lama1	UTSW	17	67780597	missense
R7688:Lama1	UTSW	17	67761628	missense
R7693:Lama1	UTSW	17	67817031	missense
R7748:Lama1	UTSW	17	67750590	missense
R7778:Lama1	UTSW	17	67804473	missense
R7824:Lama1	UTSW	17	67804473	missense
R7861:Lama1	UTSW	17	67809221	missense
R7884:Lama1	UTSW	17	67769435	missense
R8029:Lama1	UTSW	17	67817594	missense
R8078:Lama1	UTSW	17	67791294	missense
R8101:Lama1	UTSW	17	67745922	missense
R8313:Lama1	UTSW	17	67750520	missense
R8356:Lama1	UTSW	17	67737496	missense
R8366:Lama1	UTSW	17	67818704	missense
R8403:Lama1	UTSW	17	67745923	missense
R8456:Lama1	UTSW	17	67737496	missense
R8466:Lama1	UTSW	17	67813953	missense
R8678:Lama1	UTSW	17	67817103	missense
R8728:Lama1	UTSW	17	67818668	missense
R8796:Lama1	UTSW	17	67810151	missense
R8885:Lama1	UTSW	17	67773784	missense
R8893:Lama1	UTSW	17	67805372	missense
R8898:Lama1	UTSW	17	67821615	missense
R8909:Lama1	UTSW	17	67772741	missense
R9025:Lama1	UTSW	17	67812496	missense
R9045:Lama1	UTSW	17	67753843	missense
R9114:Lama1	UTSW	17	67821674	missense
R9173:Lama1	UTSW	17	67769602	missense
R9190:Lama1	UTSW	17	67804519	missense
R9381:Lama1	UTSW	17	67737484	missense
R9429:Lama1	UTSW	17	67811454	missense
R9504:Lama1	UTSW	17	67821666	missense
R9558:Lama1	UTSW	17	67817009	missense
RF001:Lama1	UTSW	17	67752902	missense
RF013:Lama1	UTSW	17	67781062	missense
V8831:Lama1	UTSW	17	67752883	missense	probably benign	0.00
X0024:Lama1	UTSW	17	67738888	missense	probably damaging	1.00
X0028:Lama1	UTSW	17	67767422	missense	probably benign	0.00
X0028:Lama1	UTSW	17	67794310	missense	probably benign	0.06
X0066:Lama1	UTSW	17	67811566	missense	probably damaging	1.00
Z1088:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1088:Lama1	UTSW	17	67771082	missense	probably benign	0.25
Z1088:Lama1	UTSW	17	67810171	missense	probably damaging	1.00
Z1176:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1177:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1191:Lama1	UTSW	17	67798644	missense

Predicted Primers

PCR Primer
(F):5'- GACAGGCAAGCTTATCCATGATG -3'
(R):5'- CTGATCCCCTGCTGAAATGAAAAC -3'

Sequencing Primer
(F):5'- GGCAAGCTTATCCATGATGTGATATG -3'
(R):5'- AGATGGCCTTCTGAACAG -3'

Posted On

2021-12-30