Incidental Mutation 'R9099:Ccdc8'
ID 691537
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Name coiled-coil domain containing 8
Synonyms ENSMUSG00000041117
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9099 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16727827-16731440 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 16728800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 96 (Y96*)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
AlphaFold D3YZV8
Predicted Effect probably null
Transcript: ENSMUST00000094805
AA Change: Y96*
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: Y96*

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,871,708 (GRCm39) M90K probably damaging Het
Actn2 T C 13: 12,303,516 (GRCm39) D428G probably damaging Het
Arrb1 T C 7: 99,243,836 (GRCm39) V262A probably damaging Het
Bok A G 1: 93,622,661 (GRCm39) I102V Het
C87436 T A 6: 86,439,567 (GRCm39) F419L probably damaging Het
Capn15 A G 17: 26,192,141 (GRCm39) C34R probably benign Het
Cd274 T A 19: 29,357,771 (GRCm39) C154* probably null Het
Cfap251 A G 5: 123,418,082 (GRCm39) probably benign Het
Ckap4 A T 10: 84,369,402 (GRCm39) L110Q probably damaging Het
Col26a1 A T 5: 136,777,202 (GRCm39) D335E probably benign Het
Crybg1 C T 10: 43,874,844 (GRCm39) V755I probably benign Het
Dhx38 A T 8: 110,282,783 (GRCm39) Y628N probably damaging Het
Dnah12 A T 14: 26,492,325 (GRCm39) K1155M probably benign Het
Ei24 A G 9: 36,697,270 (GRCm39) F153L probably damaging Het
Erg T A 16: 95,178,188 (GRCm39) E246D probably benign Het
Exoc6b T C 6: 84,982,000 (GRCm39) N99D possibly damaging Het
Fam222b G T 11: 78,046,020 (GRCm39) R527L probably damaging Het
Fam83h T C 15: 75,875,135 (GRCm39) Y734C probably damaging Het
Fbxo43 T C 15: 36,162,619 (GRCm39) E196G possibly damaging Het
Gata5 G A 2: 179,976,131 (GRCm39) P11L possibly damaging Het
Gbp3 A T 3: 142,271,048 (GRCm39) S151C probably benign Het
Gli3 T C 13: 15,901,320 (GRCm39) L1569P probably damaging Het
Helz G A 11: 107,523,041 (GRCm39) V742M probably damaging Het
Ifi27l2b A T 12: 103,418,114 (GRCm39) N175K unknown Het
Itga1 A T 13: 115,185,856 (GRCm39) Y49N probably damaging Het
Kcnk2 T C 1: 188,991,072 (GRCm39) T167A probably damaging Het
Kirrel2 T A 7: 30,147,642 (GRCm39) T669S probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Lrit2 A T 14: 36,790,812 (GRCm39) T164S possibly damaging Het
Lrriq1 A G 10: 103,051,864 (GRCm39) V296A probably damaging Het
Malsu1 C T 6: 49,050,731 (GRCm39) probably benign Het
Moxd1 G A 10: 24,155,762 (GRCm39) V289I probably damaging Het
Nfs1 C T 2: 155,968,934 (GRCm39) G380E probably damaging Het
Nol4l C A 2: 153,312,630 (GRCm39) R226L probably damaging Het
Nsmaf CAAACTTTTAAACTT CAAACTT 4: 6,416,543 (GRCm39) probably null Het
Nup98 T A 7: 101,844,173 (GRCm39) N54I probably damaging Het
Or7g21 C T 9: 19,032,890 (GRCm39) P210L probably benign Het
Or8g22 A T 9: 38,958,026 (GRCm39) C230S probably benign Het
Or8g53 A G 9: 39,683,514 (GRCm39) I194T Het
Otoa T A 7: 120,739,055 (GRCm39) F755I probably benign Het
P4htm A T 9: 108,460,911 (GRCm39) M187K probably benign Het
Phldb3 C T 7: 24,323,727 (GRCm39) R453C probably benign Het
Pkd1l1 C T 11: 8,922,986 (GRCm39) A94T Het
Pkp1 A G 1: 135,805,429 (GRCm39) F669S probably benign Het
Prl8a2 C G 13: 27,536,793 (GRCm39) Y138* probably null Het
Prl8a2 T A 13: 27,536,794 (GRCm39) Y139N probably benign Het
Rtn4r T A 16: 17,969,068 (GRCm39) N165K probably benign Het
Scaper G T 9: 55,669,616 (GRCm39) D353E probably damaging Het
Scn4a G T 11: 106,211,000 (GRCm39) D1672E probably damaging Het
She A G 3: 89,739,078 (GRCm39) S90G probably benign Het
Shmt2 A T 10: 127,355,962 (GRCm39) D130E possibly damaging Het
Slc2a12 T A 10: 22,569,923 (GRCm39) I538K possibly damaging Het
Snx29 T A 16: 11,478,435 (GRCm39) W322R probably damaging Het
Spp1 A G 5: 104,588,387 (GRCm39) D263G probably benign Het
Srek1ip1 T C 13: 104,973,964 (GRCm39) S124P possibly damaging Het
Tcp10b C T 17: 13,280,656 (GRCm39) probably benign Het
Thap12 T C 7: 98,364,600 (GRCm39) F256S probably damaging Het
Tpte T C 8: 22,845,497 (GRCm39) Y516H Het
Trem1 C A 17: 48,544,271 (GRCm39) Q99K possibly damaging Het
Umodl1 C T 17: 31,178,147 (GRCm39) P41L probably benign Het
Upp2 T C 2: 58,457,542 (GRCm39) probably null Het
Zfand1 A T 3: 10,406,148 (GRCm39) M181K probably damaging Het
Zfp292 T C 4: 34,809,228 (GRCm39) E1277G possibly damaging Het
Zfp458 G T 13: 67,405,696 (GRCm39) P248T probably damaging Het
Zfp667 T A 7: 6,308,322 (GRCm39) M330K probably benign Het
Zfp827 A G 8: 79,917,107 (GRCm39) T561A Het
Zfp947 C T 17: 22,364,855 (GRCm39) G273D probably benign Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16,729,967 (GRCm39) missense unknown
R0255:Ccdc8 UTSW 7 16,729,582 (GRCm39) missense unknown
R0504:Ccdc8 UTSW 7 16,729,939 (GRCm39) missense unknown
R3843:Ccdc8 UTSW 7 16,729,039 (GRCm39) missense probably damaging 1.00
R5054:Ccdc8 UTSW 7 16,728,970 (GRCm39) missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16,730,506 (GRCm39) missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R6244:Ccdc8 UTSW 7 16,730,176 (GRCm39) missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16,730,562 (GRCm39) nonsense probably null
R7299:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R7567:Ccdc8 UTSW 7 16,728,687 (GRCm39) missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16,730,537 (GRCm39) missense possibly damaging 0.70
R7745:Ccdc8 UTSW 7 16,729,614 (GRCm39) missense unknown
R8310:Ccdc8 UTSW 7 16,729,326 (GRCm39) missense probably damaging 1.00
R8707:Ccdc8 UTSW 7 16,729,975 (GRCm39) missense unknown
R8840:Ccdc8 UTSW 7 16,728,642 (GRCm39) missense probably damaging 1.00
R9630:Ccdc8 UTSW 7 16,728,733 (GRCm39) missense possibly damaging 0.91
R9696:Ccdc8 UTSW 7 16,730,087 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTTCGGGAGCGGCTAATC -3'
(R):5'- ACTGGAAGATTGACTCGGCG -3'

Sequencing Primer
(F):5'- AGCGGCTAATCCAGTTTTTGCAG -3'
(R):5'- AAGATTGACTCGGCGTCGTG -3'
Posted On 2021-12-30