Incidental Mutation 'R9099:Thap12'
ID 691540
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R9099 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98715393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 256 (F256S)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably damaging
Transcript: ENSMUST00000033009
AA Change: F256S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: F256S

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,980,882 M90K probably damaging Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arrb1 T C 7: 99,594,629 V262A probably damaging Het
Bok A G 1: 93,694,939 I102V Het
C87436 T A 6: 86,462,585 F419L probably damaging Het
Capn15 A G 17: 25,973,167 C34R probably benign Het
Ccdc8 T A 7: 16,994,875 Y96* probably null Het
Cd274 T A 19: 29,380,371 C154* probably null Het
Ckap4 A T 10: 84,533,538 L110Q probably damaging Het
Col26a1 A T 5: 136,748,348 D335E probably benign Het
Crybg1 C T 10: 43,998,848 V755I probably benign Het
Dhx38 A T 8: 109,556,151 Y628N probably damaging Het
Dnah12 A T 14: 26,770,368 K1155M probably benign Het
Ei24 A G 9: 36,785,974 F153L probably damaging Het
Erg T A 16: 95,377,329 E246D probably benign Het
Exoc6b T C 6: 85,005,018 N99D possibly damaging Het
Fam222b G T 11: 78,155,194 R527L probably damaging Het
Fam83h T C 15: 76,003,286 Y734C probably damaging Het
Fbxo43 T C 15: 36,162,473 E196G possibly damaging Het
Gata5 G A 2: 180,334,338 P11L possibly damaging Het
Gbp3 A T 3: 142,565,287 S151C probably benign Het
Gli3 T C 13: 15,726,735 L1569P probably damaging Het
Helz G A 11: 107,632,215 V742M probably damaging Het
Ifi27l2b A T 12: 103,451,855 N175K unknown Het
Itga1 A T 13: 115,049,320 Y49N probably damaging Het
Kcnk2 T C 1: 189,258,875 T167A probably damaging Het
Kirrel2 T A 7: 30,448,217 T669S probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrit2 A T 14: 37,068,855 T164S possibly damaging Het
Lrriq1 A G 10: 103,216,003 V296A probably damaging Het
Malsu1 C T 6: 49,073,797 probably benign Het
Moxd1 G A 10: 24,279,864 V289I probably damaging Het
Nfs1 C T 2: 156,127,014 G380E probably damaging Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Nsmaf CAAACTTTTAAACTT CAAACTT 4: 6,416,543 probably null Het
Nup98 T A 7: 102,194,966 N54I probably damaging Het
Olfr836 C T 9: 19,121,594 P210L probably benign Het
Olfr936 A T 9: 39,046,730 C230S probably benign Het
Olfr968 A G 9: 39,772,218 I194T Het
Otoa T A 7: 121,139,832 F755I probably benign Het
P4htm A T 9: 108,583,712 M187K probably benign Het
Phldb3 C T 7: 24,624,302 R453C probably benign Het
Pkd1l1 C T 11: 8,972,986 A94T Het
Pkp1 A G 1: 135,877,691 F669S probably benign Het
Prl8a2 C G 13: 27,352,810 Y138* probably null Het
Prl8a2 T A 13: 27,352,811 Y139N probably benign Het
Rtn4r T A 16: 18,151,204 N165K probably benign Het
Scaper G T 9: 55,762,332 D353E probably damaging Het
Scn4a G T 11: 106,320,174 D1672E probably damaging Het
She A G 3: 89,831,771 S90G probably benign Het
Shmt2 A T 10: 127,520,093 D130E possibly damaging Het
Slc2a12 T A 10: 22,694,024 I538K possibly damaging Het
Snx29 T A 16: 11,660,571 W322R probably damaging Het
Spp1 A G 5: 104,440,521 D263G probably benign Het
Srek1ip1 T C 13: 104,837,456 S124P possibly damaging Het
Tcp10b C T 17: 13,061,769 probably benign Het
Tpte T C 8: 22,355,481 Y516H Het
Trem1 C A 17: 48,237,243 Q99K possibly damaging Het
Umodl1 C T 17: 30,959,173 P41L probably benign Het
Upp2 T C 2: 58,567,530 probably null Het
Zfand1 A T 3: 10,341,088 M181K probably damaging Het
Zfp292 T C 4: 34,809,228 E1277G possibly damaging Het
Zfp458 G T 13: 67,257,632 P248T probably damaging Het
Zfp667 T A 7: 6,305,323 M330K probably benign Het
Zfp827 A G 8: 79,190,478 T561A Het
Zfp947 C T 17: 22,145,874 G273D probably benign Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGCCCCAGACAACTTCCAG -3'
(R):5'- GGACACAATGTAAGCCTGACC -3'

Sequencing Primer
(F):5'- GACAACTTCCAGGCGCTC -3'
(R):5'- ATGTAAGCCTGACCACGAC -3'
Posted On 2021-12-30