Incidental Mutation 'R9099:Gli3'
ID 691567
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms brachyphalangy, Bph
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9099 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 15463235-15730026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15726735 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1569 (L1569P)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: L1569P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: L1569P

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.6706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,980,882 M90K probably damaging Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arrb1 T C 7: 99,594,629 V262A probably damaging Het
Bok A G 1: 93,694,939 I102V Het
C87436 T A 6: 86,462,585 F419L probably damaging Het
Capn15 A G 17: 25,973,167 C34R probably benign Het
Ccdc8 T A 7: 16,994,875 Y96* probably null Het
Cd274 T A 19: 29,380,371 C154* probably null Het
Ckap4 A T 10: 84,533,538 L110Q probably damaging Het
Col26a1 A T 5: 136,748,348 D335E probably benign Het
Crybg1 C T 10: 43,998,848 V755I probably benign Het
Dhx38 A T 8: 109,556,151 Y628N probably damaging Het
Dnah12 A T 14: 26,770,368 K1155M probably benign Het
Ei24 A G 9: 36,785,974 F153L probably damaging Het
Erg T A 16: 95,377,329 E246D probably benign Het
Exoc6b T C 6: 85,005,018 N99D possibly damaging Het
Fam222b G T 11: 78,155,194 R527L probably damaging Het
Fam83h T C 15: 76,003,286 Y734C probably damaging Het
Fbxo43 T C 15: 36,162,473 E196G possibly damaging Het
Gata5 G A 2: 180,334,338 P11L possibly damaging Het
Gbp3 A T 3: 142,565,287 S151C probably benign Het
Helz G A 11: 107,632,215 V742M probably damaging Het
Ifi27l2b A T 12: 103,451,855 N175K unknown Het
Itga1 A T 13: 115,049,320 Y49N probably damaging Het
Kcnk2 T C 1: 189,258,875 T167A probably damaging Het
Kirrel2 T A 7: 30,448,217 T669S probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrit2 A T 14: 37,068,855 T164S possibly damaging Het
Lrriq1 A G 10: 103,216,003 V296A probably damaging Het
Malsu1 C T 6: 49,073,797 probably benign Het
Moxd1 G A 10: 24,279,864 V289I probably damaging Het
Nfs1 C T 2: 156,127,014 G380E probably damaging Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Nsmaf CAAACTTTTAAACTT CAAACTT 4: 6,416,543 probably null Het
Nup98 T A 7: 102,194,966 N54I probably damaging Het
Olfr836 C T 9: 19,121,594 P210L probably benign Het
Olfr936 A T 9: 39,046,730 C230S probably benign Het
Olfr968 A G 9: 39,772,218 I194T Het
Otoa T A 7: 121,139,832 F755I probably benign Het
P4htm A T 9: 108,583,712 M187K probably benign Het
Phldb3 C T 7: 24,624,302 R453C probably benign Het
Pkd1l1 C T 11: 8,972,986 A94T Het
Pkp1 A G 1: 135,877,691 F669S probably benign Het
Prl8a2 C G 13: 27,352,810 Y138* probably null Het
Prl8a2 T A 13: 27,352,811 Y139N probably benign Het
Rtn4r T A 16: 18,151,204 N165K probably benign Het
Scaper G T 9: 55,762,332 D353E probably damaging Het
Scn4a G T 11: 106,320,174 D1672E probably damaging Het
She A G 3: 89,831,771 S90G probably benign Het
Shmt2 A T 10: 127,520,093 D130E possibly damaging Het
Slc2a12 T A 10: 22,694,024 I538K possibly damaging Het
Snx29 T A 16: 11,660,571 W322R probably damaging Het
Spp1 A G 5: 104,440,521 D263G probably benign Het
Srek1ip1 T C 13: 104,837,456 S124P possibly damaging Het
Tcp10b C T 17: 13,061,769 probably benign Het
Thap12 T C 7: 98,715,393 F256S probably damaging Het
Tpte T C 8: 22,355,481 Y516H Het
Trem1 C A 17: 48,237,243 Q99K possibly damaging Het
Umodl1 C T 17: 30,959,173 P41L probably benign Het
Upp2 T C 2: 58,567,530 probably null Het
Wdr66 A G 5: 123,280,019 probably benign Het
Zfand1 A T 3: 10,341,088 M181K probably damaging Het
Zfp292 T C 4: 34,809,228 E1277G possibly damaging Het
Zfp458 G T 13: 67,257,632 P248T probably damaging Het
Zfp667 T A 7: 6,305,323 M330K probably benign Het
Zfp827 A G 8: 79,190,478 T561A Het
Zfp947 C T 17: 22,145,874 G273D probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
Capone UTSW 13 15715034 missense probably damaging 1.00
Carpals UTSW 13 15713650 critical splice donor site probably null
Ness UTSW 13 15723555 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
R9260:Gli3 UTSW 13 15725090 missense probably damaging 0.99
R9317:Gli3 UTSW 13 15715073 missense probably damaging 1.00
R9475:Gli3 UTSW 13 15725711 missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15613858 missense probably benign 0.00
R9571:Gli3 UTSW 13 15726273 missense probably benign 0.00
R9621:Gli3 UTSW 13 15726668 missense probably benign 0.01
R9704:Gli3 UTSW 13 15723473 missense probably damaging 1.00
R9787:Gli3 UTSW 13 15725801 missense probably damaging 0.96
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTTGACAGCTTTGAGAG -3'
(R):5'- AGGAATATACTTGAGACACATCCC -3'

Sequencing Primer
(F):5'- TGACAGCTTTGAGAGTCATGACC -3'
(R):5'- TTGAGACACATCCCAATCAGGTGAG -3'
Posted On 2021-12-30