Mutagenetix > Incidental Mutation

Incidental Mutation 'R9099:Umodl1'

691583

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9099 (G1)

Quality Score

220.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30959173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 41 (P41L)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: P41L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981
AA Change: P41L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: P41L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

94% (61/65)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,980,882	M90K	probably damaging	Het
Actn2	T	C	13: 12,288,630	D428G	probably damaging	Het
Arrb1	T	C	7: 99,594,629	V262A	probably damaging	Het
Bok	A	G	1: 93,694,939	I102V		Het
C87436	T	A	6: 86,462,585	F419L	probably damaging	Het
Capn15	A	G	17: 25,973,167	C34R	probably benign	Het
Ccdc8	T	A	7: 16,994,875	Y96*	probably null	Het
Cd274	T	A	19: 29,380,371	C154*	probably null	Het
Ckap4	A	T	10: 84,533,538	L110Q	probably damaging	Het
Col26a1	A	T	5: 136,748,348	D335E	probably benign	Het
Crybg1	C	T	10: 43,998,848	V755I	probably benign	Het
Dhx38	A	T	8: 109,556,151	Y628N	probably damaging	Het
Dnah12	A	T	14: 26,770,368	K1155M	probably benign	Het
Ei24	A	G	9: 36,785,974	F153L	probably damaging	Het
Erg	T	A	16: 95,377,329	E246D	probably benign	Het
Exoc6b	T	C	6: 85,005,018	N99D	possibly damaging	Het
Fam222b	G	T	11: 78,155,194	R527L	probably damaging	Het
Fam83h	T	C	15: 76,003,286	Y734C	probably damaging	Het
Fbxo43	T	C	15: 36,162,473	E196G	possibly damaging	Het
Gata5	G	A	2: 180,334,338	P11L	possibly damaging	Het
Gbp3	A	T	3: 142,565,287	S151C	probably benign	Het
Gli3	T	C	13: 15,726,735	L1569P	probably damaging	Het
Helz	G	A	11: 107,632,215	V742M	probably damaging	Het
Ifi27l2b	A	T	12: 103,451,855	N175K	unknown	Het
Itga1	A	T	13: 115,049,320	Y49N	probably damaging	Het
Kcnk2	T	C	1: 189,258,875	T167A	probably damaging	Het
Kirrel2	T	A	7: 30,448,217	T669S	probably benign	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lrit2	A	T	14: 37,068,855	T164S	possibly damaging	Het
Lrriq1	A	G	10: 103,216,003	V296A	probably damaging	Het
Malsu1	C	T	6: 49,073,797		probably benign	Het
Moxd1	G	A	10: 24,279,864	V289I	probably damaging	Het
Nfs1	C	T	2: 156,127,014	G380E	probably damaging	Het
Nol4l	C	A	2: 153,470,710	R226L	probably damaging	Het
Nsmaf	CAAACTTTTAAACTT	CAAACTT	4: 6,416,543		probably null	Het
Nup98	T	A	7: 102,194,966	N54I	probably damaging	Het
Olfr836	C	T	9: 19,121,594	P210L	probably benign	Het
Olfr936	A	T	9: 39,046,730	C230S	probably benign	Het
Olfr968	A	G	9: 39,772,218	I194T		Het
Otoa	T	A	7: 121,139,832	F755I	probably benign	Het
P4htm	A	T	9: 108,583,712	M187K	probably benign	Het
Phldb3	C	T	7: 24,624,302	R453C	probably benign	Het
Pkd1l1	C	T	11: 8,972,986	A94T		Het
Pkp1	A	G	1: 135,877,691	F669S	probably benign	Het
Prl8a2	C	G	13: 27,352,810	Y138*	probably null	Het
Prl8a2	T	A	13: 27,352,811	Y139N	probably benign	Het
Rtn4r	T	A	16: 18,151,204	N165K	probably benign	Het
Scaper	G	T	9: 55,762,332	D353E	probably damaging	Het
Scn4a	G	T	11: 106,320,174	D1672E	probably damaging	Het
She	A	G	3: 89,831,771	S90G	probably benign	Het
Shmt2	A	T	10: 127,520,093	D130E	possibly damaging	Het
Slc2a12	T	A	10: 22,694,024	I538K	possibly damaging	Het
Snx29	T	A	16: 11,660,571	W322R	probably damaging	Het
Spp1	A	G	5: 104,440,521	D263G	probably benign	Het
Srek1ip1	T	C	13: 104,837,456	S124P	possibly damaging	Het
Tcp10b	C	T	17: 13,061,769		probably benign	Het
Thap12	T	C	7: 98,715,393	F256S	probably damaging	Het
Tpte	T	C	8: 22,355,481	Y516H		Het
Trem1	C	A	17: 48,237,243	Q99K	possibly damaging	Het
Upp2	T	C	2: 58,567,530		probably null	Het
Wdr66	A	G	5: 123,280,019		probably benign	Het
Zfand1	A	T	3: 10,341,088	M181K	probably damaging	Het
Zfp292	T	C	4: 34,809,228	E1277G	possibly damaging	Het
Zfp458	G	T	13: 67,257,632	P248T	probably damaging	Het
Zfp667	T	A	7: 6,305,323	M330K	probably benign	Het
Zfp827	A	G	8: 79,190,478	T561A		Het
Zfp947	C	T	17: 22,145,874	G273D	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTAGGACTGTTGGGCTG -3'
(R):5'- CTCACACAGAACGCAGTAGAGG -3'

Sequencing Primer
(F):5'- GTTCTAGGGCCCATTCAACAGTAG -3'
(R):5'- AGTAGAGGCCAAGCTGCTC -3'

Posted On

2021-12-30