Mutagenetix > Incidental Mutation

Incidental Mutation 'R9099:Umodl1'

691583

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9099 (G1)

Quality Score

220.009

Status

Validated

Chromosome

Chromosomal Location

31173614-31229684 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31178147 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 41 (P41L)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: P41L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981
AA Change: P41L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: P41L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: P41L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

94% (61/65)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	T	11: 109,871,708 (GRCm39)	M90K	probably damaging	Het
Actn2	T	C	13: 12,303,516 (GRCm39)	D428G	probably damaging	Het
Arrb1	T	C	7: 99,243,836 (GRCm39)	V262A	probably damaging	Het
Bok	A	G	1: 93,622,661 (GRCm39)	I102V		Het
C87436	T	A	6: 86,439,567 (GRCm39)	F419L	probably damaging	Het
Capn15	A	G	17: 26,192,141 (GRCm39)	C34R	probably benign	Het
Ccdc8	T	A	7: 16,728,800 (GRCm39)	Y96*	probably null	Het
Cd274	T	A	19: 29,357,771 (GRCm39)	C154*	probably null	Het
Cfap251	A	G	5: 123,418,082 (GRCm39)		probably benign	Het
Ckap4	A	T	10: 84,369,402 (GRCm39)	L110Q	probably damaging	Het
Col26a1	A	T	5: 136,777,202 (GRCm39)	D335E	probably benign	Het
Crybg1	C	T	10: 43,874,844 (GRCm39)	V755I	probably benign	Het
Dhx38	A	T	8: 110,282,783 (GRCm39)	Y628N	probably damaging	Het
Dnah12	A	T	14: 26,492,325 (GRCm39)	K1155M	probably benign	Het
Ei24	A	G	9: 36,697,270 (GRCm39)	F153L	probably damaging	Het
Erg	T	A	16: 95,178,188 (GRCm39)	E246D	probably benign	Het
Exoc6b	T	C	6: 84,982,000 (GRCm39)	N99D	possibly damaging	Het
Fam222b	G	T	11: 78,046,020 (GRCm39)	R527L	probably damaging	Het
Fam83h	T	C	15: 75,875,135 (GRCm39)	Y734C	probably damaging	Het
Fbxo43	T	C	15: 36,162,619 (GRCm39)	E196G	possibly damaging	Het
Gata5	G	A	2: 179,976,131 (GRCm39)	P11L	possibly damaging	Het
Gbp3	A	T	3: 142,271,048 (GRCm39)	S151C	probably benign	Het
Gli3	T	C	13: 15,901,320 (GRCm39)	L1569P	probably damaging	Het
Helz	G	A	11: 107,523,041 (GRCm39)	V742M	probably damaging	Het
Ifi27l2b	A	T	12: 103,418,114 (GRCm39)	N175K	unknown	Het
Itga1	A	T	13: 115,185,856 (GRCm39)	Y49N	probably damaging	Het
Kcnk2	T	C	1: 188,991,072 (GRCm39)	T167A	probably damaging	Het
Kirrel2	T	A	7: 30,147,642 (GRCm39)	T669S	probably benign	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,079,903 (GRCm39)		probably benign	Het
Lrit2	A	T	14: 36,790,812 (GRCm39)	T164S	possibly damaging	Het
Lrriq1	A	G	10: 103,051,864 (GRCm39)	V296A	probably damaging	Het
Malsu1	C	T	6: 49,050,731 (GRCm39)		probably benign	Het
Moxd1	G	A	10: 24,155,762 (GRCm39)	V289I	probably damaging	Het
Nfs1	C	T	2: 155,968,934 (GRCm39)	G380E	probably damaging	Het
Nol4l	C	A	2: 153,312,630 (GRCm39)	R226L	probably damaging	Het
Nsmaf	CAAACTTTTAAACTT	CAAACTT	4: 6,416,543 (GRCm39)		probably null	Het
Nup98	T	A	7: 101,844,173 (GRCm39)	N54I	probably damaging	Het
Or7g21	C	T	9: 19,032,890 (GRCm39)	P210L	probably benign	Het
Or8g22	A	T	9: 38,958,026 (GRCm39)	C230S	probably benign	Het
Or8g53	A	G	9: 39,683,514 (GRCm39)	I194T		Het
Otoa	T	A	7: 120,739,055 (GRCm39)	F755I	probably benign	Het
P4htm	A	T	9: 108,460,911 (GRCm39)	M187K	probably benign	Het
Phldb3	C	T	7: 24,323,727 (GRCm39)	R453C	probably benign	Het
Pkd1l1	C	T	11: 8,922,986 (GRCm39)	A94T		Het
Pkp1	A	G	1: 135,805,429 (GRCm39)	F669S	probably benign	Het
Prl8a2	C	G	13: 27,536,793 (GRCm39)	Y138*	probably null	Het
Prl8a2	T	A	13: 27,536,794 (GRCm39)	Y139N	probably benign	Het
Rtn4r	T	A	16: 17,969,068 (GRCm39)	N165K	probably benign	Het
Scaper	G	T	9: 55,669,616 (GRCm39)	D353E	probably damaging	Het
Scn4a	G	T	11: 106,211,000 (GRCm39)	D1672E	probably damaging	Het
She	A	G	3: 89,739,078 (GRCm39)	S90G	probably benign	Het
Shmt2	A	T	10: 127,355,962 (GRCm39)	D130E	possibly damaging	Het
Slc2a12	T	A	10: 22,569,923 (GRCm39)	I538K	possibly damaging	Het
Snx29	T	A	16: 11,478,435 (GRCm39)	W322R	probably damaging	Het
Spp1	A	G	5: 104,588,387 (GRCm39)	D263G	probably benign	Het
Srek1ip1	T	C	13: 104,973,964 (GRCm39)	S124P	possibly damaging	Het
Tcp10b	C	T	17: 13,280,656 (GRCm39)		probably benign	Het
Thap12	T	C	7: 98,364,600 (GRCm39)	F256S	probably damaging	Het
Tpte	T	C	8: 22,845,497 (GRCm39)	Y516H		Het
Trem1	C	A	17: 48,544,271 (GRCm39)	Q99K	possibly damaging	Het
Upp2	T	C	2: 58,457,542 (GRCm39)		probably null	Het
Zfand1	A	T	3: 10,406,148 (GRCm39)	M181K	probably damaging	Het
Zfp292	T	C	4: 34,809,228 (GRCm39)	E1277G	possibly damaging	Het
Zfp458	G	T	13: 67,405,696 (GRCm39)	P248T	probably damaging	Het
Zfp667	T	A	7: 6,308,322 (GRCm39)	M330K	probably benign	Het
Zfp827	A	G	8: 79,917,107 (GRCm39)	T561A		Het
Zfp947	C	T	17: 22,364,855 (GRCm39)	G273D	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31,227,724 (GRCm39)	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	31,215,238 (GRCm39)	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	31,215,233 (GRCm39)	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	31,217,800 (GRCm39)	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	31,215,229 (GRCm39)	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	31,201,294 (GRCm39)	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	31,192,742 (GRCm39)	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	31,206,888 (GRCm39)	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	31,205,091 (GRCm39)	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	31,213,789 (GRCm39)	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	31,187,415 (GRCm39)	splice site	probably benign
IGL02496:Umodl1	APN	17	31,217,628 (GRCm39)	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	31,208,462 (GRCm39)	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	31,205,473 (GRCm39)	nonsense	probably null
IGL03392:Umodl1	APN	17	31,215,329 (GRCm39)	missense	probably damaging	0.98
Disquieting	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
floored	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7231_umodl1_507	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
surprising	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
unsettling	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
G1citation:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	31,203,002 (GRCm39)	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	31,215,325 (GRCm39)	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	31,178,347 (GRCm39)	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31,221,772 (GRCm39)	splice site	probably benign
R1231:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	31,205,478 (GRCm39)	missense	probably benign	0.05
R1459:Umodl1	UTSW	17	31,201,232 (GRCm39)	splice site	probably benign
R1510:Umodl1	UTSW	17	31,178,203 (GRCm39)	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	31,206,942 (GRCm39)	missense	probably benign
R1757:Umodl1	UTSW	17	31,227,674 (GRCm39)	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	31,187,524 (GRCm39)	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	31,201,238 (GRCm39)	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	31,211,128 (GRCm39)	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	31,211,062 (GRCm39)	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	31,211,147 (GRCm39)	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	31,208,502 (GRCm39)	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31,221,837 (GRCm39)	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	31,203,763 (GRCm39)	nonsense	probably null
R4207:Umodl1	UTSW	17	31,178,341 (GRCm39)	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	31,207,039 (GRCm39)	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	31,213,789 (GRCm39)	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	31,217,088 (GRCm39)	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	31,202,976 (GRCm39)	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	31,218,175 (GRCm39)	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	31,205,055 (GRCm39)	missense	probably benign
R4993:Umodl1	UTSW	17	31,205,459 (GRCm39)	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	31,203,066 (GRCm39)	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	31,199,333 (GRCm39)	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	31,201,263 (GRCm39)	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	31,213,761 (GRCm39)	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	31,215,256 (GRCm39)	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31,221,866 (GRCm39)	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	31,201,325 (GRCm39)	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	31,205,121 (GRCm39)	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	31,205,273 (GRCm39)	splice site	probably null
R6822:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R6999:Umodl1	UTSW	17	31,218,097 (GRCm39)	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	31,201,246 (GRCm39)	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	31,201,318 (GRCm39)	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	31,201,236 (GRCm39)	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	31,205,595 (GRCm39)	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	31,201,306 (GRCm39)	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	31,217,122 (GRCm39)	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7594:Umodl1	UTSW	17	31,173,779 (GRCm39)	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7763:Umodl1	UTSW	17	31,205,430 (GRCm39)	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	31,178,125 (GRCm39)	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	31,192,666 (GRCm39)	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	31,205,361 (GRCm39)	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	31,192,770 (GRCm39)	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	31,190,792 (GRCm39)	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	31,203,806 (GRCm39)	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	31,202,958 (GRCm39)	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	31,192,677 (GRCm39)	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9270:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	31,215,367 (GRCm39)	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	31,217,143 (GRCm39)	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	31,217,152 (GRCm39)	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	31,178,324 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTAGGACTGTTGGGCTG -3'
(R):5'- CTCACACAGAACGCAGTAGAGG -3'

Sequencing Primer
(F):5'- GTTCTAGGGCCCATTCAACAGTAG -3'
(R):5'- AGTAGAGGCCAAGCTGCTC -3'

Posted On

2021-12-30