Incidental Mutation 'R9100:Golga3'
ID 691610
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9100 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110189678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 411 (H411Y)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031477
AA Change: H451Y

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: H451Y

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: H411Y

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: H411Y

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,067 T151A probably benign Het
4932438A13Rik A G 3: 37,044,758 K1256R Het
Abcc4 A G 14: 118,616,388 V444A possibly damaging Het
Adgrl3 A C 5: 81,694,452 Q809P possibly damaging Het
Ankmy2 T C 12: 36,186,807 C205R probably damaging Het
Atp6v1b2 A G 8: 69,088,824 N11S Het
B3gnt6 T A 7: 98,194,751 M1L not run Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdca8 T C 4: 124,936,445 T45A probably benign Het
Ces2b C A 8: 104,831,589 probably benign Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot3 A G 7: 3,658,193 D567G probably benign Het
Cnot6l T C 5: 96,083,016 D364G probably damaging Het
Cpped1 A G 16: 11,828,555 V111A Het
Cyp11b2 T C 15: 74,851,146 K468E probably damaging Het
Dpp4 T G 2: 62,374,389 T245P possibly damaging Het
Fat2 A G 11: 55,262,521 W3622R probably damaging Het
Fat4 A C 3: 39,010,654 K4920Q Het
Frmpd2 A G 14: 33,530,450 I656M probably benign Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gde1 C T 7: 118,695,082 R166H probably benign Het
Gdf7 A T 12: 8,298,652 F215Y unknown Het
Gdpgp1 A G 7: 80,238,534 I104M probably benign Het
Gldc A G 19: 30,099,914 S953P possibly damaging Het
Gm13089 T G 4: 143,699,157 N72T probably benign Het
Gm5483 T A 16: 36,187,915 M57K possibly damaging Het
Gpn1 G T 5: 31,498,396 R101I probably damaging Het
Itgb5 T A 16: 33,920,181 S554T possibly damaging Het
Klhl1 G A 14: 96,346,928 L289F probably damaging Het
Klhl13 C T X: 23,247,494 R95Q probably benign Het
Kmt2d G C 15: 98,849,951 T3164R unknown Het
Knl1 T C 2: 119,068,988 V390A probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA GCCACAGCCCCCACAGGAACTACA 7: 142,175,099 probably benign Het
Lonrf1 AGGCGGCGGCGGCGG AGGCGGCGGCGG 8: 36,248,765 probably benign Het
Ltbp1 C T 17: 75,315,107 L829F probably benign Het
Ltbp1 T A 17: 75,315,108 L829H probably damaging Het
Mrgpra1 C T 7: 47,334,984 E316K probably damaging Het
Muc16 T A 9: 18,645,670 H3109L unknown Het
Nck1 T C 9: 100,495,508 E368G probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nus1 A T 10: 52,429,191 probably null Het
Nxph2 T C 2: 23,399,768 V44A probably benign Het
Olfr1029 A G 2: 85,975,752 K170E probably benign Het
Olfr1161 T C 2: 88,024,986 I88T probably benign Het
Olfr1277 A G 2: 111,269,749 L206P probably benign Het
Olfr1305 A G 2: 111,873,261 M198T possibly damaging Het
Olfr1427 G T 19: 12,098,890 H250N probably benign Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr390 A G 11: 73,787,861 K308E probably benign Het
Otof T C 5: 30,382,352 D1039G possibly damaging Het
Parpbp T A 10: 88,133,107 Q159L possibly damaging Het
Per2 A T 1: 91,423,742 L1014Q possibly damaging Het
Pik3ca A G 3: 32,460,019 N885D probably damaging Het
Pip5k1c T C 10: 81,309,222 V299A probably benign Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Pus3 C A 9: 35,565,650 Q248K probably benign Het
Sectm1a T A 11: 121,069,743 Q82L possibly damaging Het
Sema3e A G 5: 14,232,194 Y448C probably damaging Het
Slc12a4 A T 8: 105,949,142 S584T probably benign Het
Slc25a40 T C 5: 8,449,613 F249L probably benign Het
St3gal6 T A 16: 58,486,430 N79I Het
Stxbp4 A T 11: 90,535,494 I496K possibly damaging Het
Sulf1 A G 1: 12,807,894 Y202C probably damaging Het
Swt1 A G 1: 151,423,505 probably null Het
Tdrd6 T C 17: 43,625,414 Y1581C possibly damaging Het
Tenm4 G C 7: 96,845,854 G1163A probably damaging Het
Tlr4 A G 4: 66,840,281 E437G probably benign Het
Txnrd2 A T 16: 18,437,565 H101L probably damaging Het
Uba3 A T 6: 97,186,710 V306E probably damaging Het
Unc5b T C 10: 60,768,373 Q814R probably damaging Het
Vamp5 T G 6: 72,370,321 E5A possibly damaging Het
Vmn1r69 T A 7: 10,580,137 R222S probably damaging Het
Zfp507 G A 7: 35,795,021 T199I probably benign Het
Zfyve19 T G 2: 119,211,237 L95R probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTGTGCTGGCACCATTTTCC -3'
(R):5'- ACTTTGGCCATCAGTCTCTG -3'

Sequencing Primer
(F):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
(R):5'- GATACTGCTCCTCTGCCACTTGTAG -3'
Posted On 2021-12-30