Incidental Mutation 'R9100:Tenm4'
ID 691621
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9100 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 96171246-96911093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 96845854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 1163 (G1163A)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: G1162A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: G1162A

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: G1163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: G1163A

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107166
AA Change: G1126A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: G1126A

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,067 T151A probably benign Het
4932438A13Rik A G 3: 37,044,758 K1256R Het
Abcc4 A G 14: 118,616,388 V444A possibly damaging Het
Add1 T A 5: 34,613,278 probably benign Het
Adgrg3 A G 8: 95,036,263 probably benign Het
Adgrl3 A C 5: 81,694,452 Q809P possibly damaging Het
Ankmy2 T C 12: 36,186,807 C205R probably damaging Het
Atp6v1b2 A G 8: 69,088,824 N11S Het
B3gnt6 T A 7: 98,194,751 M1L not run Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdca8 T C 4: 124,936,445 T45A probably benign Het
Ces2b C A 8: 104,831,589 probably benign Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot3 A G 7: 3,658,193 D567G probably benign Het
Cnot6l T C 5: 96,083,016 D364G probably damaging Het
Cpped1 A G 16: 11,828,555 V111A Het
Cyp11b2 T C 15: 74,851,146 K468E probably damaging Het
Dpp4 T G 2: 62,374,389 T245P possibly damaging Het
Fat2 A G 11: 55,262,521 W3622R probably damaging Het
Fat4 A C 3: 39,010,654 K4920Q Het
Frmpd2 A G 14: 33,530,450 I656M probably benign Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gde1 C T 7: 118,695,082 R166H probably benign Het
Gdf7 A T 12: 8,298,652 F215Y unknown Het
Gdpgp1 A G 7: 80,238,534 I104M probably benign Het
Gldc A G 19: 30,099,914 S953P possibly damaging Het
Gm13089 T G 4: 143,699,157 N72T probably benign Het
Gm5483 T A 16: 36,187,915 M57K possibly damaging Het
Golga3 C T 5: 110,189,678 H411Y probably benign Het
Gpn1 G T 5: 31,498,396 R101I probably damaging Het
Itgb5 T A 16: 33,920,181 S554T possibly damaging Het
Klhl1 G A 14: 96,346,928 L289F probably damaging Het
Klhl13 C T X: 23,247,494 R95Q probably benign Het
Kmt2d G C 15: 98,849,951 T3164R unknown Het
Knl1 T C 2: 119,068,988 V390A probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA GCCACAGCCCCCACAGGAACTACA 7: 142,175,099 probably benign Het
Lamtor4 G A 5: 138,256,333 probably benign Het
Lonrf1 AGGCGGCGGCGGCGG AGGCGGCGGCGG 8: 36,248,765 probably benign Het
Ltbp1 C T 17: 75,315,107 L829F probably benign Het
Ltbp1 T A 17: 75,315,108 L829H probably damaging Het
Mrgpra1 C T 7: 47,334,984 E316K probably damaging Het
Muc16 T A 9: 18,645,670 H3109L unknown Het
Nck1 T C 9: 100,495,508 E368G probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nus1 A T 10: 52,429,191 probably null Het
Nxph2 T C 2: 23,399,768 V44A probably benign Het
Olfr1029 A G 2: 85,975,752 K170E probably benign Het
Olfr1161 T C 2: 88,024,986 I88T probably benign Het
Olfr1277 A G 2: 111,269,749 L206P probably benign Het
Olfr1305 A G 2: 111,873,261 M198T possibly damaging Het
Olfr1427 G T 19: 12,098,890 H250N probably benign Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr390 A G 11: 73,787,861 K308E probably benign Het
Otof T C 5: 30,382,352 D1039G possibly damaging Het
Parpbp T A 10: 88,133,107 Q159L possibly damaging Het
Per2 A T 1: 91,423,742 L1014Q possibly damaging Het
Pik3ap1 C G 19: 41,324,485 silent Het
Pik3ca A G 3: 32,460,019 N885D probably damaging Het
Pip5k1c T C 10: 81,309,222 V299A probably benign Het
Polr3h A T 15: 81,922,516 probably benign Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Pus3 C A 9: 35,565,650 Q248K probably benign Het
Sectm1a T A 11: 121,069,743 Q82L possibly damaging Het
Sema3e A G 5: 14,232,194 Y448C probably damaging Het
Slc12a4 A T 8: 105,949,142 S584T probably benign Het
Slc25a40 T C 5: 8,449,613 F249L probably benign Het
St3gal6 T A 16: 58,486,430 N79I Het
Stxbp4 A T 11: 90,535,494 I496K possibly damaging Het
Sulf1 A G 1: 12,807,894 Y202C probably damaging Het
Swt1 A G 1: 151,423,505 probably null Het
Tdrd6 T C 17: 43,625,414 Y1581C possibly damaging Het
Tlr4 A G 4: 66,840,281 E437G probably benign Het
Txnrd2 A T 16: 18,437,565 H101L probably damaging Het
Uba3 A T 6: 97,186,710 V306E probably damaging Het
Unc5b T C 10: 60,768,373 Q814R probably damaging Het
Vamp5 T G 6: 72,370,321 E5A possibly damaging Het
Vmn1r69 T A 7: 10,580,137 R222S probably damaging Het
Zfp507 G A 7: 35,795,021 T199I probably benign Het
Zfyve19 T G 2: 119,211,237 L95R probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 splice site probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96773987 missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96874213 missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96774146 missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96845808 missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96837314 missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96848017 missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96888814 missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96845926 missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96895985 missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96893014 missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96863533 missense probably benign 0.00
R7692:Tenm4 UTSW 7 96895403 missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96894702 missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96895692 missense probably benign 0.38
R7792:Tenm4 UTSW 7 96774014 missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96873874 missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96906380 missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96852357 missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96874305 missense probably benign 0.44
R8017:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96729346 splice site probably benign
R8061:Tenm4 UTSW 7 96852456 missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96854728 missense probably benign 0.39
R8140:Tenm4 UTSW 7 96895176 missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96895407 missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96772106 critical splice donor site probably null
R8542:Tenm4 UTSW 7 96811932 missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96905941 missense probably benign
R8670:Tenm4 UTSW 7 96905941 missense probably benign
R8683:Tenm4 UTSW 7 96902857 missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96905941 missense probably benign
R8692:Tenm4 UTSW 7 96905941 missense probably benign
R8714:Tenm4 UTSW 7 96905941 missense probably benign
R8716:Tenm4 UTSW 7 96905941 missense probably benign
R8735:Tenm4 UTSW 7 96905941 missense probably benign
R8736:Tenm4 UTSW 7 96905941 missense probably benign
R8737:Tenm4 UTSW 7 96905941 missense probably benign
R8738:Tenm4 UTSW 7 96873840 missense probably damaging 1.00
R8738:Tenm4 UTSW 7 96905941 missense probably benign
R8739:Tenm4 UTSW 7 96905941 missense probably benign
R8776:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96874128 missense probably benign 0.01
R8851:Tenm4 UTSW 7 96852503 missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96702745 splice site probably benign
R8977:Tenm4 UTSW 7 96811970 missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96823918 missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96823873 missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96772027 missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96892919 missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96885439 missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96896145 missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96896160 missense probably benign
R9466:Tenm4 UTSW 7 96550045 missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96823849 missense probably benign
R9626:Tenm4 UTSW 7 96896138 missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96905914 missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96863585 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGATCTGTCTGCGCTGTAG -3'
(R):5'- AAGCCCTAGCAGGTTTTGACC -3'

Sequencing Primer
(F):5'- TGTAGGCCCTGCAAGAGGAAATC -3'
(R):5'- AGACACATTCATGAGGGATTCC -3'
Posted On 2021-12-30