Incidental Mutation 'R9100:Gdf7'
ID 691642
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R9100 (G1)
Quality Score 204.009
Status Not validated
Chromosome 12
Chromosomal Location 8297918-8301954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8298652 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 215 (F215Y)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: F223Y
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: F223Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: F215Y
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,067 T151A probably benign Het
4932438A13Rik A G 3: 37,044,758 K1256R Het
Abcc4 A G 14: 118,616,388 V444A possibly damaging Het
Adgrl3 A C 5: 81,694,452 Q809P possibly damaging Het
Ankmy2 T C 12: 36,186,807 C205R probably damaging Het
Atp6v1b2 A G 8: 69,088,824 N11S Het
B3gnt6 T A 7: 98,194,751 M1L not run Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdca8 T C 4: 124,936,445 T45A probably benign Het
Ces2b C A 8: 104,831,589 probably benign Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot3 A G 7: 3,658,193 D567G probably benign Het
Cnot6l T C 5: 96,083,016 D364G probably damaging Het
Cpped1 A G 16: 11,828,555 V111A Het
Cyp11b2 T C 15: 74,851,146 K468E probably damaging Het
Dpp4 T G 2: 62,374,389 T245P possibly damaging Het
Fat2 A G 11: 55,262,521 W3622R probably damaging Het
Fat4 A C 3: 39,010,654 K4920Q Het
Frmpd2 A G 14: 33,530,450 I656M probably benign Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gde1 C T 7: 118,695,082 R166H probably benign Het
Gdpgp1 A G 7: 80,238,534 I104M probably benign Het
Gldc A G 19: 30,099,914 S953P possibly damaging Het
Gm13089 T G 4: 143,699,157 N72T probably benign Het
Gm5483 T A 16: 36,187,915 M57K possibly damaging Het
Golga3 C T 5: 110,189,678 H411Y probably benign Het
Gpn1 G T 5: 31,498,396 R101I probably damaging Het
Itgb5 T A 16: 33,920,181 S554T possibly damaging Het
Klhl1 G A 14: 96,346,928 L289F probably damaging Het
Klhl13 C T X: 23,247,494 R95Q probably benign Het
Kmt2d G C 15: 98,849,951 T3164R unknown Het
Knl1 T C 2: 119,068,988 V390A probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA GCCACAGCCCCCACAGGAACTACA 7: 142,175,099 probably benign Het
Lonrf1 AGGCGGCGGCGGCGG AGGCGGCGGCGG 8: 36,248,765 probably benign Het
Ltbp1 C T 17: 75,315,107 L829F probably benign Het
Ltbp1 T A 17: 75,315,108 L829H probably damaging Het
Mrgpra1 C T 7: 47,334,984 E316K probably damaging Het
Muc16 T A 9: 18,645,670 H3109L unknown Het
Nck1 T C 9: 100,495,508 E368G probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nus1 A T 10: 52,429,191 probably null Het
Nxph2 T C 2: 23,399,768 V44A probably benign Het
Olfr1029 A G 2: 85,975,752 K170E probably benign Het
Olfr1161 T C 2: 88,024,986 I88T probably benign Het
Olfr1277 A G 2: 111,269,749 L206P probably benign Het
Olfr1305 A G 2: 111,873,261 M198T possibly damaging Het
Olfr1427 G T 19: 12,098,890 H250N probably benign Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr390 A G 11: 73,787,861 K308E probably benign Het
Otof T C 5: 30,382,352 D1039G possibly damaging Het
Parpbp T A 10: 88,133,107 Q159L possibly damaging Het
Per2 A T 1: 91,423,742 L1014Q possibly damaging Het
Pik3ca A G 3: 32,460,019 N885D probably damaging Het
Pip5k1c T C 10: 81,309,222 V299A probably benign Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Pus3 C A 9: 35,565,650 Q248K probably benign Het
Sectm1a T A 11: 121,069,743 Q82L possibly damaging Het
Sema3e A G 5: 14,232,194 Y448C probably damaging Het
Slc12a4 A T 8: 105,949,142 S584T probably benign Het
Slc25a40 T C 5: 8,449,613 F249L probably benign Het
St3gal6 T A 16: 58,486,430 N79I Het
Stxbp4 A T 11: 90,535,494 I496K possibly damaging Het
Sulf1 A G 1: 12,807,894 Y202C probably damaging Het
Swt1 A G 1: 151,423,505 probably null Het
Tdrd6 T C 17: 43,625,414 Y1581C possibly damaging Het
Tenm4 G C 7: 96,845,854 G1163A probably damaging Het
Tlr4 A G 4: 66,840,281 E437G probably benign Het
Txnrd2 A T 16: 18,437,565 H101L probably damaging Het
Uba3 A T 6: 97,186,710 V306E probably damaging Het
Unc5b T C 10: 60,768,373 Q814R probably damaging Het
Vamp5 T G 6: 72,370,321 E5A possibly damaging Het
Vmn1r69 T A 7: 10,580,137 R222S probably damaging Het
Zfp507 G A 7: 35,795,021 T199I probably benign Het
Zfyve19 T G 2: 119,211,237 L95R probably benign Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
R8705:Gdf7 UTSW 12 8298167 missense probably damaging 0.96
R8845:Gdf7 UTSW 12 8298905 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCGGAACAGACTCTCTTTC -3'
(R):5'- TGTTCGACGTATCCAGCCTC -3'

Sequencing Primer
(F):5'- CCTTTGCGTACGGGAGGAGATC -3'
(R):5'- GACGTATCCAGCCTCTCCGAAG -3'
Posted On 2021-12-30