Incidental Mutation 'R9100:Itgb5'
ID 691651
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9100 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33920181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 554 (S554T)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069345
AA Change: S554T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: S554T

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115028
AA Change: S554T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: S554T

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232262
AA Change: S241T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,200,067 T151A probably benign Het
4932438A13Rik A G 3: 37,044,758 K1256R Het
Abcc4 A G 14: 118,616,388 V444A possibly damaging Het
Add1 T A 5: 34,613,278 probably benign Het
Adgrg3 A G 8: 95,036,263 probably benign Het
Adgrl3 A C 5: 81,694,452 Q809P possibly damaging Het
Ankmy2 T C 12: 36,186,807 C205R probably damaging Het
Atp6v1b2 A G 8: 69,088,824 N11S Het
B3gnt6 T A 7: 98,194,751 M1L not run Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdca8 T C 4: 124,936,445 T45A probably benign Het
Ces2b C A 8: 104,831,589 probably benign Het
Clip4 G A 17: 71,810,889 G310R probably damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot3 A G 7: 3,658,193 D567G probably benign Het
Cnot6l T C 5: 96,083,016 D364G probably damaging Het
Cpped1 A G 16: 11,828,555 V111A Het
Cyp11b2 T C 15: 74,851,146 K468E probably damaging Het
Dpp4 T G 2: 62,374,389 T245P possibly damaging Het
Fat2 A G 11: 55,262,521 W3622R probably damaging Het
Fat4 A C 3: 39,010,654 K4920Q Het
Frmpd2 A G 14: 33,530,450 I656M probably benign Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gde1 C T 7: 118,695,082 R166H probably benign Het
Gdf7 A T 12: 8,298,652 F215Y unknown Het
Gdpgp1 A G 7: 80,238,534 I104M probably benign Het
Gldc A G 19: 30,099,914 S953P possibly damaging Het
Gm13089 T G 4: 143,699,157 N72T probably benign Het
Gm5483 T A 16: 36,187,915 M57K possibly damaging Het
Golga3 C T 5: 110,189,678 H411Y probably benign Het
Gpn1 G T 5: 31,498,396 R101I probably damaging Het
Klhl1 G A 14: 96,346,928 L289F probably damaging Het
Klhl13 C T X: 23,247,494 R95Q probably benign Het
Kmt2d G C 15: 98,849,951 T3164R unknown Het
Knl1 T C 2: 119,068,988 V390A probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA GCCACAGCCCCCACAGGAACTACA 7: 142,175,099 probably benign Het
Lamtor4 G A 5: 138,256,333 probably benign Het
Lonrf1 AGGCGGCGGCGGCGG AGGCGGCGGCGG 8: 36,248,765 probably benign Het
Ltbp1 C T 17: 75,315,107 L829F probably benign Het
Ltbp1 T A 17: 75,315,108 L829H probably damaging Het
Mrgpra1 C T 7: 47,334,984 E316K probably damaging Het
Muc16 T A 9: 18,645,670 H3109L unknown Het
Nck1 T C 9: 100,495,508 E368G probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nus1 A T 10: 52,429,191 probably null Het
Nxph2 T C 2: 23,399,768 V44A probably benign Het
Olfr1029 A G 2: 85,975,752 K170E probably benign Het
Olfr1161 T C 2: 88,024,986 I88T probably benign Het
Olfr1277 A G 2: 111,269,749 L206P probably benign Het
Olfr1305 A G 2: 111,873,261 M198T possibly damaging Het
Olfr1427 G T 19: 12,098,890 H250N probably benign Het
Olfr213 A T 6: 116,541,029 N192I possibly damaging Het
Olfr390 A G 11: 73,787,861 K308E probably benign Het
Otof T C 5: 30,382,352 D1039G possibly damaging Het
Parpbp T A 10: 88,133,107 Q159L possibly damaging Het
Per2 A T 1: 91,423,742 L1014Q possibly damaging Het
Pik3ap1 C G 19: 41,324,485 silent Het
Pik3ca A G 3: 32,460,019 N885D probably damaging Het
Pip5k1c T C 10: 81,309,222 V299A probably benign Het
Polr3h A T 15: 81,922,516 probably benign Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Pus3 C A 9: 35,565,650 Q248K probably benign Het
Sectm1a T A 11: 121,069,743 Q82L possibly damaging Het
Sema3e A G 5: 14,232,194 Y448C probably damaging Het
Slc12a4 A T 8: 105,949,142 S584T probably benign Het
Slc25a40 T C 5: 8,449,613 F249L probably benign Het
St3gal6 T A 16: 58,486,430 N79I Het
Stxbp4 A T 11: 90,535,494 I496K possibly damaging Het
Sulf1 A G 1: 12,807,894 Y202C probably damaging Het
Swt1 A G 1: 151,423,505 probably null Het
Tdrd6 T C 17: 43,625,414 Y1581C possibly damaging Het
Tenm4 G C 7: 96,845,854 G1163A probably damaging Het
Tlr4 A G 4: 66,840,281 E437G probably benign Het
Txnrd2 A T 16: 18,437,565 H101L probably damaging Het
Uba3 A T 6: 97,186,710 V306E probably damaging Het
Unc5b T C 10: 60,768,373 Q814R probably damaging Het
Vamp5 T G 6: 72,370,321 E5A possibly damaging Het
Vmn1r69 T A 7: 10,580,137 R222S probably damaging Het
Zfp507 G A 7: 35,795,021 T199I probably benign Het
Zfyve19 T G 2: 119,211,237 L95R probably benign Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACATACACCTGTGGGCTGTG -3'
(R):5'- GTTTATAGTCCACATAAGGCCACCC -3'

Sequencing Primer
(F):5'- GCTGTGCGAGTGTGACC -3'
(R):5'- AGGGCTTGGCTTGTCCC -3'
Posted On 2021-12-30