Incidental Mutation 'R9100:Ccdc88b'
ID 691658
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms 2610041P08Rik
MMRRC Submission 068914-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9100 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6821991-6835579 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6833213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 278 (E278G)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000113440
AA Change: E278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: E278G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,853,800 (GRCm39) V444A possibly damaging Het
Add1 T A 5: 34,770,622 (GRCm39) probably benign Het
Adgrg3 A G 8: 95,762,891 (GRCm39) probably benign Het
Adgrl3 A C 5: 81,842,299 (GRCm39) Q809P possibly damaging Het
Ankmy2 T C 12: 36,236,806 (GRCm39) C205R probably damaging Het
Atp6v1b2 A G 8: 69,541,476 (GRCm39) N11S Het
B3gnt6 T A 7: 97,843,958 (GRCm39) M1L not run Het
Bltp1 A G 3: 37,098,907 (GRCm39) K1256R Het
Cdca8 T C 4: 124,830,238 (GRCm39) T45A probably benign Het
Ces2b C A 8: 105,558,221 (GRCm39) probably benign Het
Clip4 G A 17: 72,117,884 (GRCm39) G310R probably damaging Het
Cmklr1 G C 5: 113,752,043 (GRCm39) H319Q probably benign Het
Cnot3 A G 7: 3,661,192 (GRCm39) D567G probably benign Het
Cnot6l T C 5: 96,230,875 (GRCm39) D364G probably damaging Het
Cpped1 A G 16: 11,646,419 (GRCm39) V111A Het
Cstdc4 T A 16: 36,008,285 (GRCm39) M57K possibly damaging Het
Cyp11b2 T C 15: 74,722,995 (GRCm39) K468E probably damaging Het
Dpp4 T G 2: 62,204,733 (GRCm39) T245P possibly damaging Het
Efcab15 T C 11: 103,090,893 (GRCm39) T151A probably benign Het
Fat2 A G 11: 55,153,347 (GRCm39) W3622R probably damaging Het
Fat4 A C 3: 39,064,803 (GRCm39) K4920Q Het
Frmpd2 A G 14: 33,252,407 (GRCm39) I656M probably benign Het
Gck A G 11: 5,856,516 (GRCm39) Y214H probably damaging Het
Gde1 C T 7: 118,294,305 (GRCm39) R166H probably benign Het
Gdf7 A T 12: 8,348,652 (GRCm39) F215Y unknown Het
Gdpgp1 A G 7: 79,888,282 (GRCm39) I104M probably benign Het
Gldc A G 19: 30,077,314 (GRCm39) S953P possibly damaging Het
Golga3 C T 5: 110,337,544 (GRCm39) H411Y probably benign Het
Gpn1 G T 5: 31,655,740 (GRCm39) R101I probably damaging Het
Itgb5 T A 16: 33,740,551 (GRCm39) S554T possibly damaging Het
Klhl1 G A 14: 96,584,364 (GRCm39) L289F probably damaging Het
Klhl13 C T X: 23,113,733 (GRCm39) R95Q probably benign Het
Kmt2d G C 15: 98,747,832 (GRCm39) T3164R unknown Het
Knl1 T C 2: 118,899,469 (GRCm39) V390A probably benign Het
Krtap5-2 GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA GCCACAGCCCCCACAGGAACTACA 7: 141,728,836 (GRCm39) probably benign Het
Lamtor4 G A 5: 138,254,595 (GRCm39) probably benign Het
Lonrf1 AGGCGGCGGCGGCGG AGGCGGCGGCGG 8: 36,715,919 (GRCm39) probably benign Het
Ltbp1 C T 17: 75,622,102 (GRCm39) L829F probably benign Het
Ltbp1 T A 17: 75,622,103 (GRCm39) L829H probably damaging Het
Mrgpra1 C T 7: 46,984,732 (GRCm39) E316K probably damaging Het
Muc16 T A 9: 18,556,966 (GRCm39) H3109L unknown Het
Nck1 T C 9: 100,377,561 (GRCm39) E368G probably damaging Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Nus1 A T 10: 52,305,287 (GRCm39) probably null Het
Nxph2 T C 2: 23,289,780 (GRCm39) V44A probably benign Het
Or1e30 A G 11: 73,678,687 (GRCm39) K308E probably benign Het
Or4f56 A G 2: 111,703,606 (GRCm39) M198T possibly damaging Het
Or4k35 A G 2: 111,100,094 (GRCm39) L206P probably benign Het
Or4z4 G T 19: 12,076,254 (GRCm39) H250N probably benign Het
Or5d35 T C 2: 87,855,330 (GRCm39) I88T probably benign Het
Or5m11b A G 2: 85,806,096 (GRCm39) K170E probably benign Het
Or6d13 A T 6: 116,517,990 (GRCm39) N192I possibly damaging Het
Otof T C 5: 30,539,696 (GRCm39) D1039G possibly damaging Het
Parpbp T A 10: 87,968,969 (GRCm39) Q159L possibly damaging Het
Per2 A T 1: 91,351,464 (GRCm39) L1014Q possibly damaging Het
Pik3ap1 C G 19: 41,312,924 (GRCm39) silent Het
Pik3ca A G 3: 32,514,168 (GRCm39) N885D probably damaging Het
Pip5k1c T C 10: 81,145,056 (GRCm39) V299A probably benign Het
Polr3h A T 15: 81,806,717 (GRCm39) probably benign Het
Pramel11 T A 4: 143,623,646 (GRCm39) N176I probably benign Het
Pramel23 T G 4: 143,425,727 (GRCm39) N72T probably benign Het
Pus3 C A 9: 35,476,946 (GRCm39) Q248K probably benign Het
Sectm1a T A 11: 120,960,569 (GRCm39) Q82L possibly damaging Het
Sema3e A G 5: 14,282,208 (GRCm39) Y448C probably damaging Het
Slc12a4 A T 8: 106,675,774 (GRCm39) S584T probably benign Het
Slc25a40 T C 5: 8,499,613 (GRCm39) F249L probably benign Het
St3gal6 T A 16: 58,306,793 (GRCm39) N79I Het
Stxbp4 A T 11: 90,426,320 (GRCm39) I496K possibly damaging Het
Sulf1 A G 1: 12,878,118 (GRCm39) Y202C probably damaging Het
Swt1 A G 1: 151,299,256 (GRCm39) probably null Het
Tdrd6 T C 17: 43,936,305 (GRCm39) Y1581C possibly damaging Het
Tenm4 G C 7: 96,495,061 (GRCm39) G1163A probably damaging Het
Tlr4 A G 4: 66,758,518 (GRCm39) E437G probably benign Het
Txnrd2 A T 16: 18,256,315 (GRCm39) H101L probably damaging Het
Uba3 A T 6: 97,163,671 (GRCm39) V306E probably damaging Het
Unc5b T C 10: 60,604,152 (GRCm39) Q814R probably damaging Het
Vamp5 T G 6: 72,347,304 (GRCm39) E5A possibly damaging Het
Vmn1r69 T A 7: 10,314,064 (GRCm39) R222S probably damaging Het
Zfp507 G A 7: 35,494,446 (GRCm39) T199I probably benign Het
Zfyve19 T G 2: 119,041,718 (GRCm39) L95R probably benign Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6,822,454 (GRCm39) missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6,824,078 (GRCm39) missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6,823,999 (GRCm39) missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6,832,717 (GRCm39) splice site probably benign
IGL02276:Ccdc88b APN 19 6,833,475 (GRCm39) critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6,824,012 (GRCm39) missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6,834,317 (GRCm39) missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6,824,777 (GRCm39) missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6,831,151 (GRCm39) missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6,834,634 (GRCm39) missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6,831,582 (GRCm39) missense probably benign
R0920:Ccdc88b UTSW 19 6,824,017 (GRCm39) missense probably benign
R0975:Ccdc88b UTSW 19 6,823,993 (GRCm39) missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6,830,581 (GRCm39) missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6,827,739 (GRCm39) missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6,831,391 (GRCm39) missense probably benign
R1605:Ccdc88b UTSW 19 6,827,837 (GRCm39) missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6,830,690 (GRCm39) missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6,830,900 (GRCm39) nonsense probably null
R1839:Ccdc88b UTSW 19 6,831,477 (GRCm39) splice site probably benign
R1917:Ccdc88b UTSW 19 6,826,594 (GRCm39) missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6,831,452 (GRCm39) missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6,826,359 (GRCm39) missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6,827,640 (GRCm39) missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6,827,940 (GRCm39) missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6,830,368 (GRCm39) missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6,825,636 (GRCm39) missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6,835,083 (GRCm39) missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6,834,481 (GRCm39) missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6,833,509 (GRCm39) missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6,825,600 (GRCm39) missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6,835,108 (GRCm39) missense unknown
R5448:Ccdc88b UTSW 19 6,831,948 (GRCm39) missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R5783:Ccdc88b UTSW 19 6,831,284 (GRCm39) missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6,833,348 (GRCm39) missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6,826,406 (GRCm39) missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6,832,246 (GRCm39) missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6,826,409 (GRCm39) missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6,831,330 (GRCm39) missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6,834,837 (GRCm39) missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6,826,454 (GRCm39) missense probably benign
R8298:Ccdc88b UTSW 19 6,827,649 (GRCm39) missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8481:Ccdc88b UTSW 19 6,831,900 (GRCm39) missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6,824,690 (GRCm39) missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6,824,791 (GRCm39) missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R9049:Ccdc88b UTSW 19 6,826,442 (GRCm39) missense probably benign 0.37
R9113:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,831,268 (GRCm39) missense possibly damaging 0.92
R9202:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6,826,475 (GRCm39) missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6,833,541 (GRCm39) missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6,833,533 (GRCm39) missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9748:Ccdc88b UTSW 19 6,831,461 (GRCm39) missense probably damaging 1.00
R9766:Ccdc88b UTSW 19 6,833,096 (GRCm39) missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6,831,199 (GRCm39) missense probably benign
Z1176:Ccdc88b UTSW 19 6,827,108 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AATTTCAGCCTCCAAGCCCTG -3'
(R):5'- CCAGAACGATTTTGTTGGGATCG -3'

Sequencing Primer
(F):5'- TCCAAGCCCTGCACCTCG -3'
(R):5'- TGGAAGATGCTTCTTTGACCTTTGAC -3'
Posted On 2021-12-30