Incidental Mutation 'R9101:Gm597'
ID 691662
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9101 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28776659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 764 (D764V)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: D764V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: D764V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,049,395 I39N probably damaging Het
AA792892 G A 5: 94,384,040 C261Y probably damaging Het
Adam6b T C 12: 113,491,756 V731A probably benign Het
Adamts7 T C 9: 90,189,741 probably null Het
Afdn T C 17: 13,823,444 V388A probably damaging Het
Alg3 A G 16: 20,608,849 Y113H possibly damaging Het
Aox2 C T 1: 58,332,637 P820L probably benign Het
Avil A G 10: 127,017,004 D731G probably benign Het
Blvra C T 2: 127,085,970 L47F probably damaging Het
Ccdc85c C A 12: 108,274,658 R159L unknown Het
Clcn2 T C 16: 20,707,229 D797G probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Dclre1a A T 19: 56,544,306 F619I possibly damaging Het
Dnajb1 C A 8: 83,608,490 D53E probably benign Het
Dnmt1 T C 9: 20,941,543 D89G probably damaging Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gm9507 A G 10: 77,811,816 S10P unknown Het
Hacd2 G A 16: 35,099,786 V138I probably benign Het
Hhip A T 8: 80,043,962 V272D probably damaging Het
Hoga1 A C 19: 42,059,908 T72P possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kif21b G A 1: 136,151,155 G414S probably damaging Het
Klk5 T A 7: 43,850,781 D264E probably benign Het
Lars G A 18: 42,243,877 R205C probably damaging Het
Ly6a A T 15: 74,997,570 L12Q probably null Het
Marc2 T A 1: 184,822,490 R273W probably null Het
Mastl A G 2: 23,118,437 *866Q probably null Het
Mpzl3 T A 9: 45,070,685 M217K possibly damaging Het
Mroh2b T A 15: 4,900,453 M7K probably benign Het
Nefh A G 11: 4,940,925 S565P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nsd1 C T 13: 55,313,546 L2632F Het
Olfr1022 A G 2: 85,864,179 probably benign Het
Olfr1143 T C 2: 87,802,580 Y60H probably damaging Het
Olfr1243 A T 2: 89,528,377 I11N possibly damaging Het
Olfr43 C T 11: 74,206,496 C240Y probably damaging Het
Olfr550 T C 7: 102,578,930 V145A probably benign Het
Olfr616 A T 7: 103,564,473 F269I possibly damaging Het
Olfr959 T A 9: 39,572,509 Y250F probably benign Het
Pcdhga6 T C 18: 37,708,340 V371A possibly damaging Het
Pdss2 A G 10: 43,393,949 K263E possibly damaging Het
Phf3 C T 1: 30,803,945 A1978T possibly damaging Het
Phykpl C A 11: 51,592,914 T207K probably benign Het
Pkd2 T A 5: 104,480,364 C435S probably damaging Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Prkra T A 2: 76,647,840 H6L probably benign Het
Prpf39 A G 12: 65,043,304 K131E probably damaging Het
Prpf40a A G 2: 53,145,243 V762A probably benign Het
Prr27 C T 5: 87,843,471 T314I probably damaging Het
Ptges3 A G 10: 128,072,129 D116G possibly damaging Het
Rab11fip5 G T 6: 85,340,693 F1071L probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Slc45a3 T C 1: 131,977,437 V66A possibly damaging Het
Ten1 A G 11: 116,205,736 Y72C probably damaging Het
Tenm3 A G 8: 48,292,151 L1125S probably damaging Het
Thpo T A 16: 20,725,807 I159F possibly damaging Het
Tmppe T C 9: 114,405,241 S203P probably damaging Het
Ttc23l A T 15: 10,537,575 I203N probably benign Het
Vars2 A G 17: 35,659,088 L803P possibly damaging Het
Vmn2r110 T A 17: 20,574,209 I733F Het
Xxylt1 T C 16: 31,080,927 N137D possibly damaging Het
Zc3h13 G A 14: 75,323,602 R544Q unknown Het
Zfhx4 C T 3: 5,412,138 T3271I probably benign Het
Zfp943 T A 17: 21,993,411 C493S possibly damaging Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9106:Gm597 UTSW 1 28776894 missense probably benign 0.00
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GAATGAGTGCTTGTGCCAC -3'
(R):5'- AGAATCAGTGGAGGCATTCC -3'

Sequencing Primer
(F):5'- GCTTCCATGTGGAGAGTCTC -3'
(R):5'- AGGCATTCCAGCTAGTTGGCTC -3'
Posted On 2021-12-30