Incidental Mutation 'R9101:Mastl'
ID 691668
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms 2700091H24Rik, THC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9101 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 23115606-23156024 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 23118437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 866 (*866Q)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119] [ENSMUST00000028121] [ENSMUST00000114523] [ENSMUST00000114526] [ENSMUST00000114529] [ENSMUST00000226571] [ENSMUST00000227663] [ENSMUST00000228050]
AlphaFold Q8C0P0
Predicted Effect probably null
Transcript: ENSMUST00000028119
AA Change: *866Q
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: *866Q

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028121
SMART Domains Protein: ENSMUSP00000028121
Gene: ENSMUSG00000026781

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 392 414 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114523
SMART Domains Protein: ENSMUSP00000110169
Gene: ENSMUSG00000026781

DomainStartEndE-ValueType
Pfam:ACBP 8 96 2.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 393 415 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114526
SMART Domains Protein: ENSMUSP00000110172
Gene: ENSMUSG00000026781

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 44 132 4.7e-35 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 428 450 N/A INTRINSIC
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114529
SMART Domains Protein: ENSMUSP00000110175
Gene: ENSMUSG00000026781

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 45 129 4.9e-30 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 429 451 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226571
Predicted Effect probably benign
Transcript: ENSMUST00000227663
Predicted Effect probably benign
Transcript: ENSMUST00000228050
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,049,395 I39N probably damaging Het
AA792892 G A 5: 94,384,040 C261Y probably damaging Het
Adam6b T C 12: 113,491,756 V731A probably benign Het
Adamts7 T C 9: 90,189,741 probably null Het
Afdn T C 17: 13,823,444 V388A probably damaging Het
Alg3 A G 16: 20,608,849 Y113H possibly damaging Het
Aox2 C T 1: 58,332,637 P820L probably benign Het
Avil A G 10: 127,017,004 D731G probably benign Het
Blvra C T 2: 127,085,970 L47F probably damaging Het
Ccdc85c C A 12: 108,274,658 R159L unknown Het
Clcn2 T C 16: 20,707,229 D797G probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Dclre1a A T 19: 56,544,306 F619I possibly damaging Het
Dnajb1 C A 8: 83,608,490 D53E probably benign Het
Dnmt1 T C 9: 20,941,543 D89G probably damaging Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gm597 T A 1: 28,776,659 D764V probably benign Het
Gm9507 A G 10: 77,811,816 S10P unknown Het
Hacd2 G A 16: 35,099,786 V138I probably benign Het
Hhip A T 8: 80,043,962 V272D probably damaging Het
Hoga1 A C 19: 42,059,908 T72P possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kif21b G A 1: 136,151,155 G414S probably damaging Het
Klk5 T A 7: 43,850,781 D264E probably benign Het
Lars G A 18: 42,243,877 R205C probably damaging Het
Ly6a A T 15: 74,997,570 L12Q probably null Het
Marc2 T A 1: 184,822,490 R273W probably null Het
Mpzl3 T A 9: 45,070,685 M217K possibly damaging Het
Mroh2b T A 15: 4,900,453 M7K probably benign Het
Nefh A G 11: 4,940,925 S565P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nsd1 C T 13: 55,313,546 L2632F Het
Olfr1022 A G 2: 85,864,179 probably benign Het
Olfr1143 T C 2: 87,802,580 Y60H probably damaging Het
Olfr1243 A T 2: 89,528,377 I11N possibly damaging Het
Olfr43 C T 11: 74,206,496 C240Y probably damaging Het
Olfr550 T C 7: 102,578,930 V145A probably benign Het
Olfr616 A T 7: 103,564,473 F269I possibly damaging Het
Olfr959 T A 9: 39,572,509 Y250F probably benign Het
Pcdhga6 T C 18: 37,708,340 V371A possibly damaging Het
Pdss2 A G 10: 43,393,949 K263E possibly damaging Het
Phf3 C T 1: 30,803,945 A1978T possibly damaging Het
Phykpl C A 11: 51,592,914 T207K probably benign Het
Pkd2 T A 5: 104,480,364 C435S probably damaging Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Prkra T A 2: 76,647,840 H6L probably benign Het
Prpf39 A G 12: 65,043,304 K131E probably damaging Het
Prpf40a A G 2: 53,145,243 V762A probably benign Het
Prr27 C T 5: 87,843,471 T314I probably damaging Het
Ptges3 A G 10: 128,072,129 D116G possibly damaging Het
Rab11fip5 G T 6: 85,340,693 F1071L probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Slc45a3 T C 1: 131,977,437 V66A possibly damaging Het
Ten1 A G 11: 116,205,736 Y72C probably damaging Het
Tenm3 A G 8: 48,292,151 L1125S probably damaging Het
Thpo T A 16: 20,725,807 I159F possibly damaging Het
Tmppe T C 9: 114,405,241 S203P probably damaging Het
Ttc23l A T 15: 10,537,575 I203N probably benign Het
Vars2 A G 17: 35,659,088 L803P possibly damaging Het
Vmn2r110 T A 17: 20,574,209 I733F Het
Xxylt1 T C 16: 31,080,927 N137D possibly damaging Het
Zc3h13 G A 14: 75,323,602 R544Q unknown Het
Zfhx4 C T 3: 5,412,138 T3271I probably benign Het
Zfp943 T A 17: 21,993,411 C493S possibly damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCTCTATTTAGAGTGGTAGTG -3'
(R):5'- CCTGGGAGCAGAGCTTAAGTAATG -3'

Sequencing Primer
(F):5'- CTCTTCATAAAGTGCAGTGAA -3'
(R):5'- GGGAAAATCTGCAGCATC -3'
Posted On 2021-12-30