Incidental Mutation 'R9101:Clcn2'
ID 691713
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R9101 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20707229 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 797 (D797G)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably benign
Transcript: ENSMUST00000007207
AA Change: D797G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: D797G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120099
AA Change: D780G

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: D780G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect probably benign
Transcript: ENSMUST00000232309
AA Change: D753G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,049,395 I39N probably damaging Het
AA792892 G A 5: 94,384,040 C261Y probably damaging Het
Adam6b T C 12: 113,491,756 V731A probably benign Het
Adamts7 T C 9: 90,189,741 probably null Het
Afdn T C 17: 13,823,444 V388A probably damaging Het
Alg3 A G 16: 20,608,849 Y113H possibly damaging Het
Aox2 C T 1: 58,332,637 P820L probably benign Het
Avil A G 10: 127,017,004 D731G probably benign Het
Blvra C T 2: 127,085,970 L47F probably damaging Het
Ccdc85c C A 12: 108,274,658 R159L unknown Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Dclre1a A T 19: 56,544,306 F619I possibly damaging Het
Dnajb1 C A 8: 83,608,490 D53E probably benign Het
Dnmt1 T C 9: 20,941,543 D89G probably damaging Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gm597 T A 1: 28,776,659 D764V probably benign Het
Gm9507 A G 10: 77,811,816 S10P unknown Het
Hacd2 G A 16: 35,099,786 V138I probably benign Het
Hhip A T 8: 80,043,962 V272D probably damaging Het
Hoga1 A C 19: 42,059,908 T72P possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kif21b G A 1: 136,151,155 G414S probably damaging Het
Klk5 T A 7: 43,850,781 D264E probably benign Het
Lars G A 18: 42,243,877 R205C probably damaging Het
Ly6a A T 15: 74,997,570 L12Q probably null Het
Marc2 T A 1: 184,822,490 R273W probably null Het
Mastl A G 2: 23,118,437 *866Q probably null Het
Mpzl3 T A 9: 45,070,685 M217K possibly damaging Het
Mroh2b T A 15: 4,900,453 M7K probably benign Het
Nefh A G 11: 4,940,925 S565P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nsd1 C T 13: 55,313,546 L2632F Het
Olfr1022 A G 2: 85,864,179 probably benign Het
Olfr1143 T C 2: 87,802,580 Y60H probably damaging Het
Olfr1243 A T 2: 89,528,377 I11N possibly damaging Het
Olfr43 C T 11: 74,206,496 C240Y probably damaging Het
Olfr550 T C 7: 102,578,930 V145A probably benign Het
Olfr616 A T 7: 103,564,473 F269I possibly damaging Het
Olfr959 T A 9: 39,572,509 Y250F probably benign Het
Pcdhga6 T C 18: 37,708,340 V371A possibly damaging Het
Pdss2 A G 10: 43,393,949 K263E possibly damaging Het
Phf3 C T 1: 30,803,945 A1978T possibly damaging Het
Phykpl C A 11: 51,592,914 T207K probably benign Het
Pkd2 T A 5: 104,480,364 C435S probably damaging Het
Pramef6 T A 4: 143,897,076 N176I probably benign Het
Prkra T A 2: 76,647,840 H6L probably benign Het
Prpf39 A G 12: 65,043,304 K131E probably damaging Het
Prpf40a A G 2: 53,145,243 V762A probably benign Het
Prr27 C T 5: 87,843,471 T314I probably damaging Het
Ptges3 A G 10: 128,072,129 D116G possibly damaging Het
Rab11fip5 G T 6: 85,340,693 F1071L probably benign Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Slc45a3 T C 1: 131,977,437 V66A possibly damaging Het
Ten1 A G 11: 116,205,736 Y72C probably damaging Het
Tenm3 A G 8: 48,292,151 L1125S probably damaging Het
Thpo T A 16: 20,725,807 I159F possibly damaging Het
Tmppe T C 9: 114,405,241 S203P probably damaging Het
Ttc23l A T 15: 10,537,575 I203N probably benign Het
Vars2 A G 17: 35,659,088 L803P possibly damaging Het
Vmn2r110 T A 17: 20,574,209 I733F Het
Xxylt1 T C 16: 31,080,927 N137D possibly damaging Het
Zc3h13 G A 14: 75,323,602 R544Q unknown Het
Zfhx4 C T 3: 5,412,138 T3271I probably benign Het
Zfp943 T A 17: 21,993,411 C493S possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTACAGACTTACATGGC -3'
(R):5'- TAGAGTGACTCAGACCCGGAAG -3'

Sequencing Primer
(F):5'- GCTTACAGACTTACATGGCTGAAAGC -3'
(R):5'- ATGCCATTAGACTCTAGAGGGTTTC -3'
Posted On 2021-12-30