Incidental Mutation 'R9102:Vwa3b'
ID 691724
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9102 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) G to A at 37135512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
AA Change: M669I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: M669I

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195450
AA Change: M1I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam33 T C 2: 131,055,817 Q227R probably benign Het
Adgrb2 G A 4: 130,019,009 G1276D probably benign Het
Adra1b A G 11: 43,776,229 S394P possibly damaging Het
Arap2 T A 5: 62,748,998 H226L probably benign Het
Bckdk A G 7: 127,907,486 D297G probably null Het
Brwd1 T C 16: 96,068,525 T101A probably benign Het
Ciita A G 16: 10,506,701 R166G probably benign Het
Cnksr1 A G 4: 134,229,012 F587S probably damaging Het
Col4a1 A T 8: 11,203,007 C1548S possibly damaging Het
Cxcl15 G T 5: 90,801,295 M106I Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dlg5 G A 14: 24,149,499 P1446S probably damaging Het
Dnah6 A T 6: 73,067,486 I3214N probably benign Het
Dnmt3b T C 2: 153,676,783 V622A probably damaging Het
Fam170b T A 14: 32,835,447 S80T probably damaging Het
Fbxl13 G T 5: 21,632,803 H45Q probably benign Het
Fbxo39 T C 11: 72,317,490 F223L possibly damaging Het
Fndc3b C A 3: 27,468,865 probably null Het
Gbp3 G C 3: 142,567,825 V378L probably benign Het
Gc C T 5: 89,443,585 S98N probably benign Het
Gck A G 11: 5,906,516 Y214H probably damaging Het
Gpr158 A T 2: 21,825,267 S708C probably damaging Het
Hmcn1 A T 1: 150,697,580 M2106K probably benign Het
Hoxd11 T A 2: 74,682,930 Y180N possibly damaging Het
Hydin A G 8: 110,508,914 I1844V probably benign Het
Knl1 T C 2: 119,087,492 I1777T probably benign Het
Krt33b A C 11: 100,025,020 L300R probably damaging Het
Madd C T 2: 91,158,059 A1208T probably benign Het
Meis2 T A 2: 115,864,279 N461I probably benign Het
Mgat1 T A 11: 49,261,338 V216E probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Npc1l1 C T 11: 6,214,684 V1122M possibly damaging Het
Nrsn1 A G 13: 25,253,534 M137T probably benign Het
Nrxn3 T C 12: 90,332,150 S1015P probably benign Het
Nudt22 T A 19: 6,994,751 I166F probably benign Het
Olfr1106 C T 2: 87,048,827 M136I possibly damaging Het
Olfr149 A C 9: 39,702,688 V27G probably benign Het
Olfr424 A T 1: 174,136,756 N4I Het
Olfr430 T A 1: 174,069,610 F104Y probably damaging Het
Olfr878 T A 9: 37,918,696 I13N probably damaging Het
Olfr949-ps1 C T 9: 39,365,092 P178S unknown Het
Pcdha4 T A 18: 36,954,577 N604K probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Plxnc1 C T 10: 94,827,245 V1181M probably damaging Het
Pms1 G C 1: 53,267,862 H128Q probably benign Het
Prkar2b G A 12: 31,963,026 H364Y probably benign Het
Pus7 A T 5: 23,752,382 I357K possibly damaging Het
Rsf1 GCGGC GCGGCGGCGCCGGC 7: 97,579,931 probably benign Het
Siglec1 T C 2: 131,073,469 I1401V probably benign Het
Slc6a6 G T 6: 91,754,959 V590L probably benign Het
Slc9b1 C T 3: 135,394,964 P490L probably damaging Het
Sprn T C 7: 140,153,365 D98G possibly damaging Het
Srrm4 T C 5: 116,482,504 D55G unknown Het
Sugct A G 13: 17,323,248 V280A probably benign Het
Tbx6 A G 7: 126,781,842 E83G possibly damaging Het
Tmem120a T C 5: 135,736,601 T209A probably benign Het
Top3a T C 11: 60,756,329 R255G probably damaging Het
Trav6-1 T A 14: 52,638,551 F13I probably benign Het
Tsnaxip1 A G 8: 105,841,990 E410G probably benign Het
Ubr5 A G 15: 38,018,352 V842A Het
Ubtf A G 11: 102,310,189 probably null Het
Zfp518b T C 5: 38,673,838 T275A probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATAAAGCTGGTTGGACATGG -3'
(R):5'- CTCACTAGATCGCCTAAGGC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- GCCTAAGGCTCTTCAGAAAATG -3'
Posted On 2021-12-30