Incidental Mutation 'R9102:Slc6a6'
ID 691754
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 068916-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9102 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 91731940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 590 (V590L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
AlphaFold O35316
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: V590L

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: V590L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adam33 T C 2: 130,897,737 (GRCm39) Q227R probably benign Het
Adgrb2 G A 4: 129,912,802 (GRCm39) G1276D probably benign Het
Adra1b A G 11: 43,667,056 (GRCm39) S394P possibly damaging Het
Arap2 T A 5: 62,906,341 (GRCm39) H226L probably benign Het
Bckdk A G 7: 127,506,658 (GRCm39) D297G probably null Het
Brwd1 T C 16: 95,869,725 (GRCm39) T101A probably benign Het
Ciita A G 16: 10,324,565 (GRCm39) R166G probably benign Het
Cnksr1 A G 4: 133,956,323 (GRCm39) F587S probably damaging Het
Col4a1 A T 8: 11,253,007 (GRCm39) C1548S possibly damaging Het
Cxcl15 G T 5: 90,949,154 (GRCm39) M106I Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dlg5 G A 14: 24,199,567 (GRCm39) P1446S probably damaging Het
Dnah6 A T 6: 73,044,469 (GRCm39) I3214N probably benign Het
Dnmt3b T C 2: 153,518,703 (GRCm39) V622A probably damaging Het
Fam170b T A 14: 32,557,404 (GRCm39) S80T probably damaging Het
Fbxl13 G T 5: 21,837,801 (GRCm39) H45Q probably benign Het
Fbxo39 T C 11: 72,208,316 (GRCm39) F223L possibly damaging Het
Fndc3b C A 3: 27,523,014 (GRCm39) probably null Het
Gbp3 G C 3: 142,273,586 (GRCm39) V378L probably benign Het
Gc C T 5: 89,591,444 (GRCm39) S98N probably benign Het
Gck A G 11: 5,856,516 (GRCm39) Y214H probably damaging Het
Gpr158 A T 2: 21,830,078 (GRCm39) S708C probably damaging Het
Hmcn1 A T 1: 150,573,331 (GRCm39) M2106K probably benign Het
Hoxd11 T A 2: 74,513,274 (GRCm39) Y180N possibly damaging Het
Hydin A G 8: 111,235,546 (GRCm39) I1844V probably benign Het
Knl1 T C 2: 118,917,973 (GRCm39) I1777T probably benign Het
Krt33b A C 11: 99,915,846 (GRCm39) L300R probably damaging Het
Madd C T 2: 90,988,404 (GRCm39) A1208T probably benign Het
Meis2 T A 2: 115,694,760 (GRCm39) N461I probably benign Het
Mgat1 T A 11: 49,152,165 (GRCm39) V216E probably damaging Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Npc1l1 C T 11: 6,164,684 (GRCm39) V1122M possibly damaging Het
Nrsn1 A G 13: 25,437,517 (GRCm39) M137T probably benign Het
Nrxn3 T C 12: 90,298,924 (GRCm39) S1015P probably benign Het
Nudt22 T A 19: 6,972,119 (GRCm39) I166F probably benign Het
Or10d1b A C 9: 39,613,984 (GRCm39) V27G probably benign Het
Or5j1 C T 2: 86,879,171 (GRCm39) M136I possibly damaging Het
Or6k4 A T 1: 173,964,322 (GRCm39) N4I Het
Or6n2 T A 1: 173,897,176 (GRCm39) F104Y probably damaging Het
Or8b4 T A 9: 37,829,992 (GRCm39) I13N probably damaging Het
Or8g31-ps1 C T 9: 39,276,388 (GRCm39) P178S unknown Het
Pcdha4 T A 18: 37,087,630 (GRCm39) N604K probably damaging Het
Plxnc1 C T 10: 94,663,107 (GRCm39) V1181M probably damaging Het
Pms1 G C 1: 53,307,021 (GRCm39) H128Q probably benign Het
Prkar2b G A 12: 32,013,025 (GRCm39) H364Y probably benign Het
Pus7 A T 5: 23,957,380 (GRCm39) I357K possibly damaging Het
Rsf1 GCGGC GCGGCGGCGCCGGC 7: 97,229,138 (GRCm39) probably benign Het
Ryr3 T C 2: 112,508,906 (GRCm39) probably benign Het
Siglec1 T C 2: 130,915,389 (GRCm39) I1401V probably benign Het
Slc9b1 C T 3: 135,100,725 (GRCm39) P490L probably damaging Het
Sprn T C 7: 139,733,278 (GRCm39) D98G possibly damaging Het
Srrm4 T C 5: 116,620,563 (GRCm39) D55G unknown Het
Sugct A G 13: 17,497,833 (GRCm39) V280A probably benign Het
Tbx6 A G 7: 126,381,014 (GRCm39) E83G possibly damaging Het
Tmem120a T C 5: 135,765,455 (GRCm39) T209A probably benign Het
Top3a T C 11: 60,647,155 (GRCm39) R255G probably damaging Het
Trav6-1 T A 14: 52,876,008 (GRCm39) F13I probably benign Het
Tsnaxip1 A G 8: 106,568,622 (GRCm39) E410G probably benign Het
Ubr5 A G 15: 38,018,596 (GRCm39) V842A Het
Ubtf A G 11: 102,201,015 (GRCm39) probably null Het
Vwa3b G A 1: 37,174,593 (GRCm39) M1I probably null Het
Zfp518b T C 5: 38,831,181 (GRCm39) T275A probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTGTGTACCCTGTCTGTAAG -3'
(R):5'- TAAAGCTCTGTAAACCTGGTCC -3'

Sequencing Primer
(F):5'- GTACCCTGTCTGTAAGCAAGAATAC -3'
(R):5'- AGCTCTGTAAACCTGGTCCTATGAG -3'
Posted On 2021-12-30