Incidental Mutation 'R9103:Gm4787'
ID 691842
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9103 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 81376991-81379464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81378715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 223 (H223L)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: H223L

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: H223L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,938 C458* probably null Het
Adgra2 G A 8: 27,113,408 G407D probably damaging Het
Aox4 G A 1: 58,257,282 G1046E probably damaging Het
Arhgap27 A G 11: 103,360,714 Y63H probably damaging Het
Ascl3 A T 7: 109,727,920 M64K probably benign Het
Cacna2d3 G A 14: 29,347,014 T252I probably damaging Het
Capn7 A G 14: 31,369,775 T710A probably benign Het
Carmil1 A G 13: 24,111,853 C393R probably benign Het
Chd5 A C 4: 152,376,987 E1215A possibly damaging Het
Cntnap1 A G 11: 101,181,268 N449S probably benign Het
Cpz G A 5: 35,517,710 S65L probably benign Het
Cyp2c68 T A 19: 39,739,181 N118I possibly damaging Het
Ddx25 A T 9: 35,546,789 F345I probably benign Het
Dennd2d T C 3: 106,490,368 Y161H Het
E330021D16Rik T A 6: 136,401,013 D273V probably benign Het
Egfl8 C T 17: 34,614,236 D179N probably benign Het
Eif2a A G 3: 58,545,040 N174S Het
Farp1 C T 14: 121,271,692 H643Y possibly damaging Het
Fat1 G T 8: 44,951,813 V534L probably benign Het
Fbxo48 A G 11: 16,953,556 T61A probably benign Het
Fnbp4 A G 2: 90,777,843 T970A probably benign Het
Foxd1 T A 13: 98,355,255 D212E possibly damaging Het
Fstl4 C A 11: 52,773,869 H9N probably benign Het
Fyb A G 15: 6,643,751 D622G possibly damaging Het
Grin3a A G 4: 49,771,179 V531A probably damaging Het
Gzmb T C 14: 56,261,165 D42G probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hsd17b6 A G 10: 127,998,007 W2R probably damaging Het
Hspa4l T C 3: 40,760,917 probably null Het
Igtp A G 11: 58,206,900 E299G Het
Klhl28 T C 12: 64,943,526 D547G possibly damaging Het
Leng8 G C 7: 4,143,898 R473P probably damaging Het
Lin37 T A 7: 30,557,630 N53Y possibly damaging Het
Lrp1 G A 10: 127,595,110 Q357* probably null Het
Lrrfip2 A T 9: 111,205,772 K176N probably damaging Het
Ltbp4 A G 7: 27,328,761 S390P unknown Het
Map3k2 G A 18: 32,220,572 R465H possibly damaging Het
Mthfd1 T A 12: 76,303,743 V665E probably damaging Het
Myh3 A T 11: 67,098,625 I1524F probably benign Het
Myo1g A G 11: 6,516,153 S339P possibly damaging Het
Nf1 A G 11: 79,559,506 K506R probably damaging Het
Nudt21 A G 8: 94,019,693 I225T probably benign Het
Olfr1009 T A 2: 85,722,183 Y259* probably null Het
Olfr1183 A G 2: 88,461,598 K105R probably benign Het
Olfr147 A G 9: 38,403,222 Y116C probably damaging Het
Olfr504 A T 7: 108,565,573 L74Q probably benign Het
Olfr896-ps1 A T 9: 38,292,673 I243F probably damaging Het
Pax2 C T 19: 44,818,529 T299I probably benign Het
Pde4dip C T 3: 97,841,728 S99N probably damaging Het
Pdlim5 T A 3: 142,304,413 H147L possibly damaging Het
Pfkfb3 T A 2: 11,482,570 Y343F probably damaging Het
Phf10 A G 17: 14,954,120 I232T probably damaging Het
Plcb3 C T 19: 6,958,920 G745D probably benign Het
Pramef6 G A 4: 143,897,811 L39F probably damaging Het
Recql C A 6: 142,376,789 C129F possibly damaging Het
Rrp1 C T 10: 78,405,042 D288N unknown Het
Samd4 T C 14: 47,016,609 Y177H probably benign Het
Sim1 T A 10: 50,909,429 M198K possibly damaging Het
Six4 T C 12: 73,109,190 I334M probably damaging Het
Slc27a6 T C 18: 58,572,196 S217P probably damaging Het
Slc2a4 T A 11: 69,945,392 K264N probably benign Het
Slc8b1 A T 5: 120,532,874 I476F probably benign Het
Smcp T C 3: 92,584,531 D3G unknown Het
Tagap A T 17: 7,933,503 M507L probably benign Het
Thap11 A G 8: 105,856,148 E263G probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Top3a T G 11: 60,763,427 probably null Het
Vmn1r31 A G 6: 58,472,088 V264A unknown Het
Vti1a A C 19: 55,328,433 M81L probably benign Het
Wscd1 T C 11: 71,783,419 probably null Het
Zfp595 T C 13: 67,316,612 E532G probably damaging Het
Zranb1 T A 7: 132,982,438 V539D probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81377905 missense probably benign 0.01
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81378151 missense probably benign 0.00
R8314:Gm4787 UTSW 12 81379135 missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81377506 missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81377269 missense probably benign 0.00
R9457:Gm4787 UTSW 12 81379246 missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81379300 nonsense probably null
R9608:Gm4787 UTSW 12 81378312 missense probably benign 0.03
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGCTCCATATGCCAAAAG -3'
(R):5'- CTTGTGGTGGACGAAAGGTC -3'

Sequencing Primer
(F):5'- TATGCCAAAAGTAACCAGCTTTC -3'
(R):5'- GGCAAAGGTAGGTAACCT -3'
Posted On 2021-12-30