Incidental Mutation 'R9104:Dpp10'
ID 691863
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123411755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 348 (S348T)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000112603
AA Change: S337T

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: S337T

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: S348T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: S348T

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Meta Mutation Damage Score 0.2417 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,570,071 N127K probably damaging Het
Adgrl3 C T 5: 81,310,065 A14V probably benign Het
Adra2b A G 2: 127,363,938 Y125C probably damaging Het
Ahnak T A 19: 9,010,347 H2998Q probably benign Het
B3galt1 C A 2: 68,118,062 H40Q probably benign Het
Best3 T G 10: 117,024,775 L647V probably benign Het
Brip1 T A 11: 86,187,071 E177V possibly damaging Het
C1qtnf6 T C 15: 78,524,909 D246G probably benign Het
C4b G A 17: 34,729,259 T1622M probably benign Het
Catip G A 1: 74,362,523 probably null Het
Ccdc138 T C 10: 58,513,160 V176A probably benign Het
Ccdc85a T C 11: 28,576,879 H243R probably damaging Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Copz2 G A 11: 96,856,688 D166N possibly damaging Het
Dedd C T 1: 171,341,004 L253F probably damaging Het
Dennd5a A G 7: 109,898,506 probably null Het
Eci3 A G 13: 34,960,399 probably null Het
Egr4 A G 6: 85,513,355 S15P probably benign Het
Elp6 A G 9: 110,305,329 T12A probably benign Het
Ewsr1 G T 11: 5,091,367 P113T unknown Het
Exosc10 T G 4: 148,580,402 L789R probably benign Het
Flt4 A G 11: 49,634,334 Y669C probably damaging Het
Foxred2 A T 15: 77,952,317 F333I probably damaging Het
Frs2 G T 10: 117,074,165 H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm19410 T C 8: 35,780,467 Y478H probably damaging Het
Gm3460 G A 14: 6,619,543 R150C Het
Grik4 A C 9: 42,659,872 L179R probably damaging Het
Gsdmc3 C T 15: 63,859,092 probably null Het
Il20ra T A 10: 19,759,616 M535K probably benign Het
Il9 A G 13: 56,480,588 V96A possibly damaging Het
Itgal A G 7: 127,311,622 D592G probably damaging Het
Klk11 C T 7: 43,778,451 probably benign Het
Klk1b27 G A 7: 44,055,886 W159* probably null Het
Mapk9 T C 11: 49,869,173 Y105H probably damaging Het
Mmp7 A G 9: 7,697,946 probably benign Het
Muc2 T C 7: 141,699,655 I118T probably damaging Het
N4bp2l2 T C 5: 150,643,259 N131D unknown Het
Nbea A C 3: 55,955,388 S1814R probably benign Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr335-ps T C 2: 36,301,944 V135A Het
Olfr809 T C 10: 129,776,652 V261A probably damaging Het
Olfr944 G A 9: 39,217,535 M59I probably damaging Het
Pbx3 C A 2: 34,224,617 D102Y probably damaging Het
Pdia6 G A 12: 17,270,491 V44I probably benign Het
Pkdcc G A 17: 83,221,042 R280H probably damaging Het
Ppm1h A G 10: 122,802,359 E178G probably benign Het
Prom1 C T 5: 44,014,819 S619N probably benign Het
Prtg A C 9: 72,848,325 I270L probably damaging Het
Rfx6 A T 10: 51,723,010 H487L probably damaging Het
Rpl18a A C 8: 70,896,144 Y63D probably benign Het
Rtl1 T A 12: 109,594,284 M374L probably benign Het
Scaper A G 9: 55,912,116 L105P unknown Het
Slc16a13 T A 11: 70,220,704 probably benign Het
Slc6a13 A G 6: 121,336,085 K487R probably benign Het
Slc7a11 T A 3: 50,377,633 T459S probably benign Het
Smarcad1 A G 6: 65,098,665 Q708R probably benign Het
Stat2 T C 10: 128,281,242 probably null Het
Syde1 T C 10: 78,585,836 H627R probably benign Het
Tas2r113 G A 6: 132,893,153 R48H probably benign Het
Tbc1d16 T C 11: 119,147,800 Y690C probably damaging Het
Tchh A T 3: 93,447,303 H1350L unknown Het
Tex15 T A 8: 33,570,922 Y127N possibly damaging Het
Thsd4 T C 9: 60,056,896 T438A possibly damaging Het
Tubg1 A G 11: 101,124,273 D216G probably benign Het
Tyk2 T C 9: 21,115,466 D642G possibly damaging Het
Uqcc1 C T 2: 155,901,297 probably null Het
Uvssa A C 5: 33,414,060 K683Q probably damaging Het
Vmn1r59 A T 7: 5,454,167 M198K probably benign Het
Zfp772 T A 7: 7,204,191 H167L possibly damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCTCAGTCAGAAAGTGTACAC -3'
(R):5'- TGGAAAAGTCAAGTGTAGGCTAGTTTC -3'

Sequencing Primer
(F):5'- CTCAGTCAGAAAGTGTACACATTAAC -3'
(R):5'- TGTACACAGAATACAATATCCT -3'
Posted On 2021-12-30