Incidental Mutation 'R9104:Slc7a11'
ID 691871
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50377633 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 459 (T459S)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably benign
Transcript: ENSMUST00000029297
AA Change: T459S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: T459S

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194462
AA Change: T459S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: T459S

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,570,071 N127K probably damaging Het
Adgrl3 C T 5: 81,310,065 A14V probably benign Het
Adra2b A G 2: 127,363,938 Y125C probably damaging Het
Ahnak T A 19: 9,010,347 H2998Q probably benign Het
B3galt1 C A 2: 68,118,062 H40Q probably benign Het
Best3 T G 10: 117,024,775 L647V probably benign Het
Brip1 T A 11: 86,187,071 E177V possibly damaging Het
C1qtnf6 T C 15: 78,524,909 D246G probably benign Het
C4b G A 17: 34,729,259 T1622M probably benign Het
Catip G A 1: 74,362,523 probably null Het
Ccdc138 T C 10: 58,513,160 V176A probably benign Het
Ccdc85a T C 11: 28,576,879 H243R probably damaging Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Copz2 G A 11: 96,856,688 D166N possibly damaging Het
Dedd C T 1: 171,341,004 L253F probably damaging Het
Dennd5a A G 7: 109,898,506 probably null Het
Dpp10 A T 1: 123,411,755 S348T probably damaging Het
Eci3 A G 13: 34,960,399 probably null Het
Egr4 A G 6: 85,513,355 S15P probably benign Het
Elp6 A G 9: 110,305,329 T12A probably benign Het
Ewsr1 G T 11: 5,091,367 P113T unknown Het
Exosc10 T G 4: 148,580,402 L789R probably benign Het
Flt4 A G 11: 49,634,334 Y669C probably damaging Het
Foxred2 A T 15: 77,952,317 F333I probably damaging Het
Frs2 G T 10: 117,074,165 H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm19410 T C 8: 35,780,467 Y478H probably damaging Het
Gm3460 G A 14: 6,619,543 R150C Het
Grik4 A C 9: 42,659,872 L179R probably damaging Het
Gsdmc3 C T 15: 63,859,092 probably null Het
Il20ra T A 10: 19,759,616 M535K probably benign Het
Il9 A G 13: 56,480,588 V96A possibly damaging Het
Itgal A G 7: 127,311,622 D592G probably damaging Het
Klk11 C T 7: 43,778,451 probably benign Het
Klk1b27 G A 7: 44,055,886 W159* probably null Het
Mapk9 T C 11: 49,869,173 Y105H probably damaging Het
Mmp7 A G 9: 7,697,946 probably benign Het
Muc2 T C 7: 141,699,655 I118T probably damaging Het
N4bp2l2 T C 5: 150,643,259 N131D unknown Het
Nbea A C 3: 55,955,388 S1814R probably benign Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr335-ps T C 2: 36,301,944 V135A Het
Olfr809 T C 10: 129,776,652 V261A probably damaging Het
Olfr944 G A 9: 39,217,535 M59I probably damaging Het
Pbx3 C A 2: 34,224,617 D102Y probably damaging Het
Pdia6 G A 12: 17,270,491 V44I probably benign Het
Pkdcc G A 17: 83,221,042 R280H probably damaging Het
Ppm1h A G 10: 122,802,359 E178G probably benign Het
Prom1 C T 5: 44,014,819 S619N probably benign Het
Prtg A C 9: 72,848,325 I270L probably damaging Het
Rfx6 A T 10: 51,723,010 H487L probably damaging Het
Rpl18a A C 8: 70,896,144 Y63D probably benign Het
Rtl1 T A 12: 109,594,284 M374L probably benign Het
Scaper A G 9: 55,912,116 L105P unknown Het
Slc16a13 T A 11: 70,220,704 probably benign Het
Slc6a13 A G 6: 121,336,085 K487R probably benign Het
Smarcad1 A G 6: 65,098,665 Q708R probably benign Het
Stat2 T C 10: 128,281,242 probably null Het
Syde1 T C 10: 78,585,836 H627R probably benign Het
Tas2r113 G A 6: 132,893,153 R48H probably benign Het
Tbc1d16 T C 11: 119,147,800 Y690C probably damaging Het
Tchh A T 3: 93,447,303 H1350L unknown Het
Tex15 T A 8: 33,570,922 Y127N possibly damaging Het
Thsd4 T C 9: 60,056,896 T438A possibly damaging Het
Tubg1 A G 11: 101,124,273 D216G probably benign Het
Tyk2 T C 9: 21,115,466 D642G possibly damaging Het
Uqcc1 C T 2: 155,901,297 probably null Het
Uvssa A C 5: 33,414,060 K683Q probably damaging Het
Vmn1r59 A T 7: 5,454,167 M198K probably benign Het
Zfp772 T A 7: 7,204,191 H167L possibly damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50438856 missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50427752 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCGTTGTGCCACTAGTAGC -3'
(R):5'- AAGAAATTATACTGACCTGCTCTGC -3'

Sequencing Primer
(F):5'- TGCCACTAGTAGCTTTATTCTCTAAG -3'
(R):5'- ATACTGACCTGCTCTGCGATGAC -3'
Posted On 2021-12-30