Incidental Mutation 'R9104:Slc6a13'
ID 691881
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121313044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 487 (K487R)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580]
AlphaFold P31649
Predicted Effect probably benign
Transcript: ENSMUST00000064580
AA Change: K487R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: K487R

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 44,023,108 (GRCm39) N127K probably damaging Het
Adgrl3 C T 5: 81,457,912 (GRCm39) A14V probably benign Het
Adra2b A G 2: 127,205,858 (GRCm39) Y125C probably damaging Het
Ahnak T A 19: 8,987,711 (GRCm39) H2998Q probably benign Het
B3galt1 C A 2: 67,948,406 (GRCm39) H40Q probably benign Het
Best3 T G 10: 116,860,680 (GRCm39) L647V probably benign Het
Brip1 T A 11: 86,077,897 (GRCm39) E177V possibly damaging Het
C1qtnf6 T C 15: 78,409,109 (GRCm39) D246G probably benign Het
C4b G A 17: 34,948,233 (GRCm39) T1622M probably benign Het
Catip G A 1: 74,401,682 (GRCm39) probably null Het
Ccdc138 T C 10: 58,348,982 (GRCm39) V176A probably benign Het
Ccdc85a T C 11: 28,526,879 (GRCm39) H243R probably damaging Het
Cep19 C T 16: 31,925,883 (GRCm39) T97M probably damaging Het
Copz2 G A 11: 96,747,514 (GRCm39) D166N possibly damaging Het
Dedd C T 1: 171,168,572 (GRCm39) L253F probably damaging Het
Dennd5a A G 7: 109,497,713 (GRCm39) probably null Het
Dpp10 A T 1: 123,339,484 (GRCm39) S348T probably damaging Het
Eci3 A G 13: 35,144,382 (GRCm39) probably null Het
Egr4 A G 6: 85,490,337 (GRCm39) S15P probably benign Het
Elp6 A G 9: 110,134,397 (GRCm39) T12A probably benign Het
Ewsr1 G T 11: 5,041,367 (GRCm39) P113T unknown Het
Exosc10 T G 4: 148,664,859 (GRCm39) L789R probably benign Het
Flt4 A G 11: 49,525,161 (GRCm39) Y669C probably damaging Het
Foxred2 A T 15: 77,836,517 (GRCm39) F333I probably damaging Het
Frs2 G T 10: 116,910,070 (GRCm39) H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gm19410 T C 8: 36,247,621 (GRCm39) Y478H probably damaging Het
Gm3629 G A 14: 17,834,542 (GRCm39) R150C Het
Grik4 A C 9: 42,571,168 (GRCm39) L179R probably damaging Het
Gsdmc3 C T 15: 63,730,941 (GRCm39) probably null Het
Il20ra T A 10: 19,635,364 (GRCm39) M535K probably benign Het
Il9 A G 13: 56,628,401 (GRCm39) V96A possibly damaging Het
Itgal A G 7: 126,910,794 (GRCm39) D592G probably damaging Het
Klk1b11 C T 7: 43,427,875 (GRCm39) probably benign Het
Klk1b27 G A 7: 43,705,310 (GRCm39) W159* probably null Het
Mapk9 T C 11: 49,760,000 (GRCm39) Y105H probably damaging Het
Mmp7 A G 9: 7,697,947 (GRCm39) probably benign Het
Muc2 T C 7: 141,286,224 (GRCm39) I118T probably damaging Het
N4bp2l2 T C 5: 150,566,724 (GRCm39) N131D unknown Het
Nbea A C 3: 55,862,809 (GRCm39) S1814R probably benign Het
Nlrp9c G T 7: 26,081,837 (GRCm39) L630I probably benign Het
Or1j8 T C 2: 36,191,956 (GRCm39) V135A Het
Or6c76 T C 10: 129,612,521 (GRCm39) V261A probably damaging Het
Or8g27 G A 9: 39,128,831 (GRCm39) M59I probably damaging Het
Pbx3 C A 2: 34,114,629 (GRCm39) D102Y probably damaging Het
Pdia6 G A 12: 17,320,492 (GRCm39) V44I probably benign Het
Pkdcc G A 17: 83,528,471 (GRCm39) R280H probably damaging Het
Ppm1h A G 10: 122,638,264 (GRCm39) E178G probably benign Het
Prom1 C T 5: 44,172,161 (GRCm39) S619N probably benign Het
Prtg A C 9: 72,755,607 (GRCm39) I270L probably damaging Het
Rfx6 A T 10: 51,599,106 (GRCm39) H487L probably damaging Het
Rpl18a A C 8: 71,348,788 (GRCm39) Y63D probably benign Het
Rtl1 T A 12: 109,560,718 (GRCm39) M374L probably benign Het
Scaper A G 9: 55,819,400 (GRCm39) L105P unknown Het
Slc16a13 T A 11: 70,111,530 (GRCm39) probably benign Het
Slc7a11 T A 3: 50,332,082 (GRCm39) T459S probably benign Het
Smarcad1 A G 6: 65,075,649 (GRCm39) Q708R probably benign Het
Stat2 T C 10: 128,117,111 (GRCm39) probably null Het
Syde1 T C 10: 78,421,670 (GRCm39) H627R probably benign Het
Tas2r113 G A 6: 132,870,116 (GRCm39) R48H probably benign Het
Tbc1d16 T C 11: 119,038,626 (GRCm39) Y690C probably damaging Het
Tchh A T 3: 93,354,610 (GRCm39) H1350L unknown Het
Tex15 T A 8: 34,060,950 (GRCm39) Y127N possibly damaging Het
Thsd4 T C 9: 59,964,179 (GRCm39) T438A possibly damaging Het
Tubg1 A G 11: 101,015,099 (GRCm39) D216G probably benign Het
Tyk2 T C 9: 21,026,762 (GRCm39) D642G possibly damaging Het
Uqcc1 C T 2: 155,743,217 (GRCm39) probably null Het
Uvssa A C 5: 33,571,404 (GRCm39) K683Q probably damaging Het
Vmn1r59 A T 7: 5,457,166 (GRCm39) M198K probably benign Het
Zfp772 T A 7: 7,207,190 (GRCm39) H167L possibly damaging Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATGGTTTCAAAAGGCAGCC -3'
(R):5'- GGCTAATCCCTCTGAGAAAGG -3'

Sequencing Primer
(F):5'- CAAAAGGCAGCCGCGCC -3'
(R):5'- GGGAAGGGAGGAATTCATCTTC -3'
Posted On 2021-12-30