Incidental Mutation 'R9104:Klk1b27'
ID 691886
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Name kallikrein 1-related peptidase b27
Synonyms mGK-27, Klk27, Klk21l
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 44052290-44056712 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 44055886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 159 (W159*)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
AlphaFold Q9JM71
Predicted Effect probably null
Transcript: ENSMUST00000079859
AA Change: W159*
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: W159*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,570,071 N127K probably damaging Het
Adgrl3 C T 5: 81,310,065 A14V probably benign Het
Adra2b A G 2: 127,363,938 Y125C probably damaging Het
Ahnak T A 19: 9,010,347 H2998Q probably benign Het
B3galt1 C A 2: 68,118,062 H40Q probably benign Het
Best3 T G 10: 117,024,775 L647V probably benign Het
Brip1 T A 11: 86,187,071 E177V possibly damaging Het
C1qtnf6 T C 15: 78,524,909 D246G probably benign Het
C4b G A 17: 34,729,259 T1622M probably benign Het
Catip G A 1: 74,362,523 probably null Het
Ccdc138 T C 10: 58,513,160 V176A probably benign Het
Ccdc85a T C 11: 28,576,879 H243R probably damaging Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Copz2 G A 11: 96,856,688 D166N possibly damaging Het
Dedd C T 1: 171,341,004 L253F probably damaging Het
Dennd5a A G 7: 109,898,506 probably null Het
Dpp10 A T 1: 123,411,755 S348T probably damaging Het
Eci3 A G 13: 34,960,399 probably null Het
Egr4 A G 6: 85,513,355 S15P probably benign Het
Elp6 A G 9: 110,305,329 T12A probably benign Het
Ewsr1 G T 11: 5,091,367 P113T unknown Het
Exosc10 T G 4: 148,580,402 L789R probably benign Het
Flt4 A G 11: 49,634,334 Y669C probably damaging Het
Foxred2 A T 15: 77,952,317 F333I probably damaging Het
Frs2 G T 10: 117,074,165 H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm19410 T C 8: 35,780,467 Y478H probably damaging Het
Gm3460 G A 14: 6,619,543 R150C Het
Grik4 A C 9: 42,659,872 L179R probably damaging Het
Gsdmc3 C T 15: 63,859,092 probably null Het
Il20ra T A 10: 19,759,616 M535K probably benign Het
Il9 A G 13: 56,480,588 V96A possibly damaging Het
Itgal A G 7: 127,311,622 D592G probably damaging Het
Mapk9 T C 11: 49,869,173 Y105H probably damaging Het
Muc2 T C 7: 141,699,655 I118T probably damaging Het
N4bp2l2 T C 5: 150,643,259 N131D unknown Het
Nbea A C 3: 55,955,388 S1814R probably benign Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr335-ps T C 2: 36,301,944 V135A Het
Olfr809 T C 10: 129,776,652 V261A probably damaging Het
Olfr944 G A 9: 39,217,535 M59I probably damaging Het
Pbx3 C A 2: 34,224,617 D102Y probably damaging Het
Pdia6 G A 12: 17,270,491 V44I probably benign Het
Pkdcc G A 17: 83,221,042 R280H probably damaging Het
Ppm1h A G 10: 122,802,359 E178G probably benign Het
Prom1 C T 5: 44,014,819 S619N probably benign Het
Prtg A C 9: 72,848,325 I270L probably damaging Het
Rfx6 A T 10: 51,723,010 H487L probably damaging Het
Rpl18a A C 8: 70,896,144 Y63D probably benign Het
Rtl1 T A 12: 109,594,284 M374L probably benign Het
Scaper A G 9: 55,912,116 L105P unknown Het
Slc16a13 T A 11: 70,220,704 probably benign Het
Slc6a13 A G 6: 121,336,085 K487R probably benign Het
Slc7a11 T A 3: 50,377,633 T459S probably benign Het
Smarcad1 A G 6: 65,098,665 Q708R probably benign Het
Stat2 T C 10: 128,281,242 probably null Het
Syde1 T C 10: 78,585,836 H627R probably benign Het
Tas2r113 G A 6: 132,893,153 R48H probably benign Het
Tbc1d16 T C 11: 119,147,800 Y690C probably damaging Het
Tchh A T 3: 93,447,303 H1350L unknown Het
Tex15 T A 8: 33,570,922 Y127N possibly damaging Het
Thsd4 T C 9: 60,056,896 T438A possibly damaging Het
Tubg1 A G 11: 101,124,273 D216G probably benign Het
Tyk2 T C 9: 21,115,466 D642G possibly damaging Het
Uqcc1 C T 2: 155,901,297 probably null Het
Uvssa A C 5: 33,414,060 K683Q probably damaging Het
Vmn1r59 A T 7: 5,454,167 M198K probably benign Het
Zfp772 T A 7: 7,204,191 H167L possibly damaging Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
R8969:Klk1b27 UTSW 7 44054508 missense probably damaging 0.99
R8994:Klk1b27 UTSW 7 44055712 missense probably damaging 1.00
R9020:Klk1b27 UTSW 7 44055694 missense probably damaging 1.00
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACGTGAACCCTCTGCTCAG -3'
(R):5'- CACAGTTCTCATTGGGCAGG -3'

Sequencing Primer
(F):5'- TGGGTCAGCAAAAGCTTCC -3'
(R):5'- GAGCTTGATGAACACACACTG -3'
Posted On 2021-12-30