Incidental Mutation 'R9104:Il20ra'
ID 691901
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 19588318-19635801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19635364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 535 (M535K)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably benign
Transcript: ENSMUST00000020185
AA Change: M535K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: M535K

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 44,023,108 (GRCm39) N127K probably damaging Het
Adgrl3 C T 5: 81,457,912 (GRCm39) A14V probably benign Het
Adra2b A G 2: 127,205,858 (GRCm39) Y125C probably damaging Het
Ahnak T A 19: 8,987,711 (GRCm39) H2998Q probably benign Het
B3galt1 C A 2: 67,948,406 (GRCm39) H40Q probably benign Het
Best3 T G 10: 116,860,680 (GRCm39) L647V probably benign Het
Brip1 T A 11: 86,077,897 (GRCm39) E177V possibly damaging Het
C1qtnf6 T C 15: 78,409,109 (GRCm39) D246G probably benign Het
C4b G A 17: 34,948,233 (GRCm39) T1622M probably benign Het
Catip G A 1: 74,401,682 (GRCm39) probably null Het
Ccdc138 T C 10: 58,348,982 (GRCm39) V176A probably benign Het
Ccdc85a T C 11: 28,526,879 (GRCm39) H243R probably damaging Het
Cep19 C T 16: 31,925,883 (GRCm39) T97M probably damaging Het
Copz2 G A 11: 96,747,514 (GRCm39) D166N possibly damaging Het
Dedd C T 1: 171,168,572 (GRCm39) L253F probably damaging Het
Dennd5a A G 7: 109,497,713 (GRCm39) probably null Het
Dpp10 A T 1: 123,339,484 (GRCm39) S348T probably damaging Het
Eci3 A G 13: 35,144,382 (GRCm39) probably null Het
Egr4 A G 6: 85,490,337 (GRCm39) S15P probably benign Het
Elp6 A G 9: 110,134,397 (GRCm39) T12A probably benign Het
Ewsr1 G T 11: 5,041,367 (GRCm39) P113T unknown Het
Exosc10 T G 4: 148,664,859 (GRCm39) L789R probably benign Het
Flt4 A G 11: 49,525,161 (GRCm39) Y669C probably damaging Het
Foxred2 A T 15: 77,836,517 (GRCm39) F333I probably damaging Het
Frs2 G T 10: 116,910,070 (GRCm39) H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gm19410 T C 8: 36,247,621 (GRCm39) Y478H probably damaging Het
Gm3629 G A 14: 17,834,542 (GRCm39) R150C Het
Grik4 A C 9: 42,571,168 (GRCm39) L179R probably damaging Het
Gsdmc3 C T 15: 63,730,941 (GRCm39) probably null Het
Il9 A G 13: 56,628,401 (GRCm39) V96A possibly damaging Het
Itgal A G 7: 126,910,794 (GRCm39) D592G probably damaging Het
Klk1b11 C T 7: 43,427,875 (GRCm39) probably benign Het
Klk1b27 G A 7: 43,705,310 (GRCm39) W159* probably null Het
Mapk9 T C 11: 49,760,000 (GRCm39) Y105H probably damaging Het
Mmp7 A G 9: 7,697,947 (GRCm39) probably benign Het
Muc2 T C 7: 141,286,224 (GRCm39) I118T probably damaging Het
N4bp2l2 T C 5: 150,566,724 (GRCm39) N131D unknown Het
Nbea A C 3: 55,862,809 (GRCm39) S1814R probably benign Het
Nlrp9c G T 7: 26,081,837 (GRCm39) L630I probably benign Het
Or1j8 T C 2: 36,191,956 (GRCm39) V135A Het
Or6c76 T C 10: 129,612,521 (GRCm39) V261A probably damaging Het
Or8g27 G A 9: 39,128,831 (GRCm39) M59I probably damaging Het
Pbx3 C A 2: 34,114,629 (GRCm39) D102Y probably damaging Het
Pdia6 G A 12: 17,320,492 (GRCm39) V44I probably benign Het
Pkdcc G A 17: 83,528,471 (GRCm39) R280H probably damaging Het
Ppm1h A G 10: 122,638,264 (GRCm39) E178G probably benign Het
Prom1 C T 5: 44,172,161 (GRCm39) S619N probably benign Het
Prtg A C 9: 72,755,607 (GRCm39) I270L probably damaging Het
Rfx6 A T 10: 51,599,106 (GRCm39) H487L probably damaging Het
Rpl18a A C 8: 71,348,788 (GRCm39) Y63D probably benign Het
Rtl1 T A 12: 109,560,718 (GRCm39) M374L probably benign Het
Scaper A G 9: 55,819,400 (GRCm39) L105P unknown Het
Slc16a13 T A 11: 70,111,530 (GRCm39) probably benign Het
Slc6a13 A G 6: 121,313,044 (GRCm39) K487R probably benign Het
Slc7a11 T A 3: 50,332,082 (GRCm39) T459S probably benign Het
Smarcad1 A G 6: 65,075,649 (GRCm39) Q708R probably benign Het
Stat2 T C 10: 128,117,111 (GRCm39) probably null Het
Syde1 T C 10: 78,421,670 (GRCm39) H627R probably benign Het
Tas2r113 G A 6: 132,870,116 (GRCm39) R48H probably benign Het
Tbc1d16 T C 11: 119,038,626 (GRCm39) Y690C probably damaging Het
Tchh A T 3: 93,354,610 (GRCm39) H1350L unknown Het
Tex15 T A 8: 34,060,950 (GRCm39) Y127N possibly damaging Het
Thsd4 T C 9: 59,964,179 (GRCm39) T438A possibly damaging Het
Tubg1 A G 11: 101,015,099 (GRCm39) D216G probably benign Het
Tyk2 T C 9: 21,026,762 (GRCm39) D642G possibly damaging Het
Uqcc1 C T 2: 155,743,217 (GRCm39) probably null Het
Uvssa A C 5: 33,571,404 (GRCm39) K683Q probably damaging Het
Vmn1r59 A T 7: 5,457,166 (GRCm39) M198K probably benign Het
Zfp772 T A 7: 7,207,190 (GRCm39) H167L possibly damaging Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19,635,019 (GRCm39) missense probably benign 0.01
IGL01936:Il20ra APN 10 19,631,591 (GRCm39) missense probably damaging 1.00
IGL01958:Il20ra APN 10 19,634,791 (GRCm39) missense probably benign 0.39
IGL02109:Il20ra APN 10 19,635,253 (GRCm39) missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19,627,326 (GRCm39) missense probably damaging 0.99
IGL02234:Il20ra APN 10 19,625,018 (GRCm39) missense probably damaging 1.00
IGL02959:Il20ra APN 10 19,634,789 (GRCm39) missense probably benign 0.10
IGL03010:Il20ra APN 10 19,624,960 (GRCm39) missense probably damaging 1.00
P0017:Il20ra UTSW 10 19,635,154 (GRCm39) missense probably damaging 1.00
R0518:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R0521:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R1436:Il20ra UTSW 10 19,625,000 (GRCm39) missense probably damaging 1.00
R1714:Il20ra UTSW 10 19,631,576 (GRCm39) missense probably damaging 0.98
R1792:Il20ra UTSW 10 19,635,384 (GRCm39) missense probably damaging 0.99
R1852:Il20ra UTSW 10 19,618,767 (GRCm39) missense probably damaging 1.00
R2097:Il20ra UTSW 10 19,635,211 (GRCm39) missense probably damaging 1.00
R4559:Il20ra UTSW 10 19,625,032 (GRCm39) missense probably damaging 0.99
R4970:Il20ra UTSW 10 19,634,691 (GRCm39) missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19,634,691 (GRCm39) missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19,625,107 (GRCm39) missense probably damaging 0.99
R6543:Il20ra UTSW 10 19,625,071 (GRCm39) missense probably damaging 1.00
R6755:Il20ra UTSW 10 19,626,542 (GRCm39) missense probably benign 0.15
R6845:Il20ra UTSW 10 19,635,059 (GRCm39) missense probably benign 0.06
R7014:Il20ra UTSW 10 19,588,458 (GRCm39) missense unknown
R7190:Il20ra UTSW 10 19,618,689 (GRCm39) missense probably damaging 0.99
R8134:Il20ra UTSW 10 19,626,452 (GRCm39) missense probably damaging 0.99
R8955:Il20ra UTSW 10 19,635,160 (GRCm39) missense possibly damaging 0.57
R9439:Il20ra UTSW 10 19,618,751 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGTAGTGGATTGGGACCC -3'
(R):5'- CTCTCTGTGGATTGGGAAGAAG -3'

Sequencing Primer
(F):5'- CTCAAACTGGCAGGCTGTGTATC -3'
(R):5'- TTGGATGGAAGCCAATCACATG -3'
Posted On 2021-12-30