Incidental Mutation 'R9104:Il20ra'
ID 691901
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9104 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19759616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 535 (M535K)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably benign
Transcript: ENSMUST00000020185
AA Change: M535K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: M535K

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,570,071 N127K probably damaging Het
Adgrl3 C T 5: 81,310,065 A14V probably benign Het
Adra2b A G 2: 127,363,938 Y125C probably damaging Het
Ahnak T A 19: 9,010,347 H2998Q probably benign Het
B3galt1 C A 2: 68,118,062 H40Q probably benign Het
Best3 T G 10: 117,024,775 L647V probably benign Het
Brip1 T A 11: 86,187,071 E177V possibly damaging Het
C1qtnf6 T C 15: 78,524,909 D246G probably benign Het
C4b G A 17: 34,729,259 T1622M probably benign Het
Catip G A 1: 74,362,523 probably null Het
Ccdc138 T C 10: 58,513,160 V176A probably benign Het
Ccdc85a T C 11: 28,576,879 H243R probably damaging Het
Cep19 C T 16: 32,107,065 T97M probably damaging Het
Copz2 G A 11: 96,856,688 D166N possibly damaging Het
Dedd C T 1: 171,341,004 L253F probably damaging Het
Dennd5a A G 7: 109,898,506 probably null Het
Dpp10 A T 1: 123,411,755 S348T probably damaging Het
Eci3 A G 13: 34,960,399 probably null Het
Egr4 A G 6: 85,513,355 S15P probably benign Het
Elp6 A G 9: 110,305,329 T12A probably benign Het
Ewsr1 G T 11: 5,091,367 P113T unknown Het
Exosc10 T G 4: 148,580,402 L789R probably benign Het
Flt4 A G 11: 49,634,334 Y669C probably damaging Het
Foxred2 A T 15: 77,952,317 F333I probably damaging Het
Frs2 G T 10: 117,074,165 H431N probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm19410 T C 8: 35,780,467 Y478H probably damaging Het
Gm3460 G A 14: 6,619,543 R150C Het
Grik4 A C 9: 42,659,872 L179R probably damaging Het
Gsdmc3 C T 15: 63,859,092 probably null Het
Il9 A G 13: 56,480,588 V96A possibly damaging Het
Itgal A G 7: 127,311,622 D592G probably damaging Het
Klk11 C T 7: 43,778,451 probably benign Het
Klk1b27 G A 7: 44,055,886 W159* probably null Het
Mapk9 T C 11: 49,869,173 Y105H probably damaging Het
Mmp7 A G 9: 7,697,946 probably benign Het
Muc2 T C 7: 141,699,655 I118T probably damaging Het
N4bp2l2 T C 5: 150,643,259 N131D unknown Het
Nbea A C 3: 55,955,388 S1814R probably benign Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr335-ps T C 2: 36,301,944 V135A Het
Olfr809 T C 10: 129,776,652 V261A probably damaging Het
Olfr944 G A 9: 39,217,535 M59I probably damaging Het
Pbx3 C A 2: 34,224,617 D102Y probably damaging Het
Pdia6 G A 12: 17,270,491 V44I probably benign Het
Pkdcc G A 17: 83,221,042 R280H probably damaging Het
Ppm1h A G 10: 122,802,359 E178G probably benign Het
Prom1 C T 5: 44,014,819 S619N probably benign Het
Prtg A C 9: 72,848,325 I270L probably damaging Het
Rfx6 A T 10: 51,723,010 H487L probably damaging Het
Rpl18a A C 8: 70,896,144 Y63D probably benign Het
Rtl1 T A 12: 109,594,284 M374L probably benign Het
Scaper A G 9: 55,912,116 L105P unknown Het
Slc16a13 T A 11: 70,220,704 probably benign Het
Slc6a13 A G 6: 121,336,085 K487R probably benign Het
Slc7a11 T A 3: 50,377,633 T459S probably benign Het
Smarcad1 A G 6: 65,098,665 Q708R probably benign Het
Stat2 T C 10: 128,281,242 probably null Het
Syde1 T C 10: 78,585,836 H627R probably benign Het
Tas2r113 G A 6: 132,893,153 R48H probably benign Het
Tbc1d16 T C 11: 119,147,800 Y690C probably damaging Het
Tchh A T 3: 93,447,303 H1350L unknown Het
Tex15 T A 8: 33,570,922 Y127N possibly damaging Het
Thsd4 T C 9: 60,056,896 T438A possibly damaging Het
Tubg1 A G 11: 101,124,273 D216G probably benign Het
Tyk2 T C 9: 21,115,466 D642G possibly damaging Het
Uqcc1 C T 2: 155,901,297 probably null Het
Uvssa A C 5: 33,414,060 K683Q probably damaging Het
Vmn1r59 A T 7: 5,454,167 M198K probably benign Het
Zfp772 T A 7: 7,204,191 H167L possibly damaging Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGTAGTGGATTGGGACCC -3'
(R):5'- CTCTCTGTGGATTGGGAAGAAG -3'

Sequencing Primer
(F):5'- CTCAAACTGGCAGGCTGTGTATC -3'
(R):5'- TTGGATGGAAGCCAATCACATG -3'
Posted On 2021-12-30