Incidental Mutation 'R9105:1700017N19Rik'
ID 691971
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene Name RIKEN cDNA 1700017N19 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9105 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 100590484-100618401 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 100603545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 139 (K139*)
Ref Sequence ENSEMBL: ENSMUSP00000042828 (fasta)
AlphaFold A0A087WPJ1
Predicted Effect probably null
Transcript: ENSMUST00000041162
AA Change: K139*
Predicted Effect probably benign
Transcript: ENSMUST00000186825
Predicted Effect probably null
Transcript: ENSMUST00000187119
AA Change: K139*
Predicted Effect probably null
Transcript: ENSMUST00000188736
AA Change: K139*
Predicted Effect probably benign
Transcript: ENSMUST00000188930
Predicted Effect probably null
Transcript: ENSMUST00000190386
AA Change: K139*
Predicted Effect probably null
Transcript: ENSMUST00000190708
AA Change: K193*
Predicted Effect probably null
Transcript: ENSMUST00000191336
AA Change: K71*
Predicted Effect probably null
Transcript: ENSMUST00000218464
AA Change: K139*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,280,570 K221I probably benign Het
Actrt2 G A 4: 154,667,220 T153I probably damaging Het
Adam34 C T 8: 43,650,748 C620Y probably damaging Het
Adgrl2 T C 3: 148,837,653 K812E possibly damaging Het
Aig1 T C 10: 13,653,595 T224A probably benign Het
Apbb2 G T 5: 66,302,672 S694* probably null Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Bcl3 T A 7: 19,809,250 I352F probably damaging Het
Btbd19 C T 4: 117,120,764 R276Q probably damaging Het
Btnl9 G A 11: 49,175,634 P368S probably benign Het
Ccdc97 T C 7: 25,713,112 T302A probably benign Het
Cdh11 T C 8: 102,634,336 D790G probably damaging Het
Cep350 T C 1: 155,959,815 N45S probably damaging Het
Col5a2 T A 1: 45,380,206 Y1238F probably benign Het
Ctdspl2 C T 2: 122,006,870 L373F probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dolpp1 A T 2: 30,399,140 probably null Het
Efr3b A T 12: 3,981,782 L340Q probably damaging Het
Ehd4 T C 2: 120,102,279 N222S probably damaging Het
Fam26e A G 10: 34,092,148 V303A probably benign Het
Flywch1 TTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTT 17: 23,755,655 probably benign Het
Frmd4a A G 2: 4,535,183 I205V probably damaging Het
G6pc3 C T 11: 102,193,577 A271V probably benign Het
Gab1 T C 8: 80,788,960 D243G probably damaging Het
Gbp9 A G 5: 105,094,076 I205T probably benign Het
Gm340 G A 19: 41,584,872 A689T possibly damaging Het
Gtf2b T A 3: 142,783,289 F304Y probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ip6k3 A G 17: 27,145,195 L293P probably damaging Het
Itgb7 A G 15: 102,227,469 S44P probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lancl1 T A 1: 67,004,803 Y346F possibly damaging Het
Lca5l T G 16: 96,159,471 E602A probably damaging Het
Lrp1b A G 2: 41,506,791 V421A Het
Lrrtm3 A G 10: 64,088,557 V277A possibly damaging Het
Lypla1 T C 1: 4,841,059 L189P probably damaging Het
Msantd3 A T 4: 48,560,963 N180Y possibly damaging Het
Muc3 T C 5: 137,142,390 Y131C Het
Myo19 T C 11: 84,903,203 I651T probably damaging Het
Ndst2 T C 14: 20,730,002 S57G probably benign Het
Olfr106-ps C T 17: 37,394,840 T100I probably benign Het
Olfr1222 C T 2: 89,125,651 V27I probably benign Het
Olfr342 A G 2: 36,528,282 Y290C probably damaging Het
Olfr414 T A 1: 174,431,295 I289N probably damaging Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 T A 15: 79,299,197 probably null Het
Pnrc1 C A 4: 33,246,207 G251* probably null Het
Psg17 A T 7: 18,821,408 V3E probably benign Het
Slc12a5 A G 2: 164,996,194 T982A probably benign Het
Srrd T C 5: 112,337,599 D286G possibly damaging Het
Tcp10b T C 17: 13,066,349 S153P probably benign Het
Tmem131 C A 1: 36,815,510 S886I probably benign Het
Ttk T A 9: 83,863,491 D630E probably damaging Het
Vnn3 T C 10: 23,864,563 W255R probably damaging Het
Wdfy3 T C 5: 101,882,646 Q2332R probably benign Het
Xkr8 A T 4: 132,732,337 Y43* probably null Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0145:1700017N19Rik UTSW 10 100601921 missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R3952:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 splice site probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100609176 missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100612829 nonsense probably null
R7870:1700017N19Rik UTSW 10 100605643 missense probably benign
R7914:1700017N19Rik UTSW 10 100592676 missense probably benign
R8466:1700017N19Rik UTSW 10 100602011 missense probably benign 0.00
R8558:1700017N19Rik UTSW 10 100594635 missense probably benign 0.23
R9004:1700017N19Rik UTSW 10 100618335 unclassified probably benign
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100612429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTTTATGGACAAAGACCCCTG -3'
(R):5'- CCTTTCTCACTCACAAACTGGATG -3'

Sequencing Primer
(F):5'- TGGACAAAGACCCCTGAAGAAATTG -3'
(R):5'- GCTCTAGTGTACACTGCA -3'
Posted On 2021-12-30