Incidental Mutation 'R9105:Myo19'
ID 691973
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Name myosin XIX
Synonyms Myohd1, 1110055A02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9105 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84880148-84911226 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84903203 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 651 (I651T)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093969]
AlphaFold Q5SV80
Predicted Effect probably damaging
Transcript: ENSMUST00000093969
AA Change: I651T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: I651T

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,603,545 K139* probably null Het
Acsl5 A T 19: 55,280,570 K221I probably benign Het
Actrt2 G A 4: 154,667,220 T153I probably damaging Het
Adam34 C T 8: 43,650,748 C620Y probably damaging Het
Adgrl2 T C 3: 148,837,653 K812E possibly damaging Het
Aig1 T C 10: 13,653,595 T224A probably benign Het
Apbb2 G T 5: 66,302,672 S694* probably null Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Bcl3 T A 7: 19,809,250 I352F probably damaging Het
Btbd19 C T 4: 117,120,764 R276Q probably damaging Het
Btnl9 G A 11: 49,175,634 P368S probably benign Het
Ccdc97 T C 7: 25,713,112 T302A probably benign Het
Cdh11 T C 8: 102,634,336 D790G probably damaging Het
Cep350 T C 1: 155,959,815 N45S probably damaging Het
Col5a2 T A 1: 45,380,206 Y1238F probably benign Het
Ctdspl2 C T 2: 122,006,870 L373F probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dolpp1 A T 2: 30,399,140 probably null Het
Efr3b A T 12: 3,981,782 L340Q probably damaging Het
Ehd4 T C 2: 120,102,279 N222S probably damaging Het
Fam26e A G 10: 34,092,148 V303A probably benign Het
Flywch1 TTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTT 17: 23,755,655 probably benign Het
Frmd4a A G 2: 4,535,183 I205V probably damaging Het
G6pc3 C T 11: 102,193,577 A271V probably benign Het
Gab1 T C 8: 80,788,960 D243G probably damaging Het
Gbp9 A G 5: 105,094,076 I205T probably benign Het
Gm340 G A 19: 41,584,872 A689T possibly damaging Het
Gtf2b T A 3: 142,783,289 F304Y probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ip6k3 A G 17: 27,145,195 L293P probably damaging Het
Itgb7 A G 15: 102,227,469 S44P probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lancl1 T A 1: 67,004,803 Y346F possibly damaging Het
Lca5l T G 16: 96,159,471 E602A probably damaging Het
Lrp1b A G 2: 41,506,791 V421A Het
Lrrtm3 A G 10: 64,088,557 V277A possibly damaging Het
Lypla1 T C 1: 4,841,059 L189P probably damaging Het
Msantd3 A T 4: 48,560,963 N180Y possibly damaging Het
Muc3 T C 5: 137,142,390 Y131C Het
Ndst2 T C 14: 20,730,002 S57G probably benign Het
Olfr106-ps C T 17: 37,394,840 T100I probably benign Het
Olfr1222 C T 2: 89,125,651 V27I probably benign Het
Olfr342 A G 2: 36,528,282 Y290C probably damaging Het
Olfr414 T A 1: 174,431,295 I289N probably damaging Het
Pik3c2a T C 7: 116,372,814 T794A probably benign Het
Pla2g6 T A 15: 79,299,197 probably null Het
Pnrc1 C A 4: 33,246,207 G251* probably null Het
Psg17 A T 7: 18,821,408 V3E probably benign Het
Slc12a5 A G 2: 164,996,194 T982A probably benign Het
Srrd T C 5: 112,337,599 D286G possibly damaging Het
Tcp10b T C 17: 13,066,349 S153P probably benign Het
Tmem131 C A 1: 36,815,510 S886I probably benign Het
Ttk T A 9: 83,863,491 D630E probably damaging Het
Vnn3 T C 10: 23,864,563 W255R probably damaging Het
Wdfy3 T C 5: 101,882,646 Q2332R probably benign Het
Xkr8 A T 4: 132,732,337 Y43* probably null Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84900220 missense probably damaging 1.00
BB014:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 splice site probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6444:Myo19 UTSW 11 84895308 missense probably benign
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7921:Myo19 UTSW 11 84908238 missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84885710 missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84900220 missense probably damaging 1.00
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTATATGAGGAGCCAGGTAC -3'
(R):5'- TCCATAGGAATGTAGGCCCTAC -3'

Sequencing Primer
(F):5'- TCGGTTTCTCATGATCCCACAGAG -3'
(R):5'- CCAGGGCAGAGATTCCACACTG -3'
Posted On 2021-12-30