Incidental Mutation 'R9106:Gm597'
ID 691989
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Name predicted gene 597
Synonyms LOC210962
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9106 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 28776117-28780252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28776894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 686 (I686V)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: I686V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: I686V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,328,870 V1138A possibly damaging Het
Ahctf1 C A 1: 179,787,036 K394N probably benign Het
Armc4 A T 18: 7,294,527 S29T probably benign Het
Banp A T 8: 121,978,633 T81S possibly damaging Het
Btn2a2 T C 13: 23,478,295 E495G probably benign Het
Cfap69 T C 5: 5,640,190 I158M possibly damaging Het
Cgnl1 C A 9: 71,721,591 probably benign Het
Clip1 T A 5: 123,615,160 Q186L probably damaging Het
Clspn G A 4: 126,577,450 probably benign Het
Cnst A G 1: 179,604,597 E224G probably damaging Het
Ctdsp1 T C 1: 74,394,725 L155P probably damaging Het
D5Ertd579e C T 5: 36,616,338 A238T probably benign Het
Dnah6 T C 6: 73,144,769 Y1410C probably damaging Het
Elmsan1 T C 12: 84,152,553 Y1040C probably damaging Het
Fam186a AGCCGCTGCCGCTGCCGCTGCCGC AGCCGCTGCCGCTGCCGC 15: 99,946,226 probably benign Het
Farp2 T C 1: 93,561,188 probably null Het
Galnt7 T G 8: 57,532,695 D547A probably damaging Het
Gm1527 C A 3: 28,902,291 D135E probably damaging Het
Grm5 T C 7: 88,074,539 I679T probably damaging Het
Hectd4 C A 5: 121,329,556 R2523S possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Htr1f A T 16: 64,926,274 S218R probably damaging Het
Lrit1 G A 14: 37,054,934 A4T unknown Het
Ly6f G T 15: 75,269,857 D50Y probably damaging Het
Mafg GGTTCTTCAGTGT GGT 11: 120,629,589 probably null Het
Map2 T A 1: 66,415,363 Y1137* probably null Het
Map4k3 C A 17: 80,727,828 R21L possibly damaging Het
Mapk10 A T 5: 103,038,576 V90D probably damaging Het
Mapkapk3 T A 9: 107,258,868 E219V probably damaging Het
Mos T G 4: 3,871,457 I120L probably benign Het
Mrgprb4 A G 7: 48,198,931 V83A probably benign Het
Mrnip A G 11: 50,174,941 Q19R probably damaging Het
Myrip T C 9: 120,432,478 S386P probably benign Het
Mzt2 A G 16: 15,848,704 W141R probably benign Het
Ncam1 A G 9: 49,517,556 Y710H probably damaging Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr1201 A G 2: 88,794,672 T97A probably benign Het
Olfr243 G A 7: 103,717,530 C312Y probably benign Het
Olfr420 A G 1: 174,158,803 Q10R probably benign Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Oplah C A 15: 76,305,676 G150C probably benign Het
Patl1 A G 19: 11,931,609 K460R probably damaging Het
Pdgfrb A T 18: 61,046,028 probably null Het
Phldb2 T C 16: 45,860,394 I17V probably benign Het
Ppp3r1 A G 11: 17,194,789 D134G probably damaging Het
Ppp4r4 C T 12: 103,604,056 T763I probably benign Het
Prmt9 A G 8: 77,549,729 D61G probably benign Het
Ptk2 T C 15: 73,259,608 M589V possibly damaging Het
Rabl6 A G 2: 25,596,434 W153R probably benign Het
Rb1cc1 A G 1: 6,248,885 I843V Het
Rnf19b A G 4: 129,084,147 E719G Het
Sart3 T C 5: 113,754,349 D363G possibly damaging Het
Sgo2a C A 1: 57,998,124 D9E possibly damaging Het
Slc27a5 A G 7: 12,991,170 V450A probably benign Het
Slc8b1 T A 5: 120,530,351 Y483N probably damaging Het
Slco1b2 A G 6: 141,672,248 T475A probably damaging Het
Slfn3 T C 11: 83,212,632 F110L probably benign Het
Ssr2 T A 3: 88,587,962 Y175N probably damaging Het
Tagap A T 17: 7,931,448 N222Y probably damaging Het
Tecta C T 9: 42,367,183 V1010M probably benign Het
Trim36 A T 18: 46,167,597 I669N possibly damaging Het
Ubp1 A G 9: 113,970,251 T425A probably benign Het
Usp47 T C 7: 112,082,506 I508T probably damaging Het
Vit G A 17: 78,626,849 D627N probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3615:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
R8514:Gm597 UTSW 1 28778505 missense probably damaging 1.00
R8944:Gm597 UTSW 1 28777074 missense probably benign 0.00
R9042:Gm597 UTSW 1 28776956 missense possibly damaging 0.72
R9101:Gm597 UTSW 1 28776659 missense probably benign 0.04
R9173:Gm597 UTSW 1 28777349 missense probably benign 0.22
R9596:Gm597 UTSW 1 28776607 missense probably benign 0.07
R9632:Gm597 UTSW 1 28778039 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CATTGATGCCTGAGTGCAGC -3'
(R):5'- CCAGGGATTTTGAAACGTGGAG -3'

Sequencing Primer
(F):5'- CCTGAGTGCAGCTTATGTTCAG -3'
(R):5'- ACGTGGAGGCATAAACTCTTTG -3'
Posted On 2021-12-30