Incidental Mutation 'R9106:Usp47'
ID 692021
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Name ubiquitin specific peptidase 47
Synonyms A630020C16Rik, 4930502N04Rik
MMRRC Submission 068970-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R9106 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 111622692-111710591 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111681713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 508 (I508T)
Ref Sequence ENSEMBL: ENSMUSP00000147619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
AlphaFold Q8BY87
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: I488T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: I488T

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210309
AA Change: I508T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215510
AA Change: I508T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 C A 1: 179,614,601 (GRCm39) K394N probably benign Het
Banp A T 8: 122,705,372 (GRCm39) T81S possibly damaging Het
Btn2a2 T C 13: 23,662,465 (GRCm39) E495G probably benign Het
Cfap69 T C 5: 5,690,190 (GRCm39) I158M possibly damaging Het
Cgnl1 C A 9: 71,628,873 (GRCm39) probably benign Het
Clip1 T A 5: 123,753,223 (GRCm39) Q186L probably damaging Het
Clspn G A 4: 126,471,243 (GRCm39) probably benign Het
Cnst A G 1: 179,432,162 (GRCm39) E224G probably damaging Het
Ctdsp1 T C 1: 74,433,884 (GRCm39) L155P probably damaging Het
D5Ertd579e C T 5: 36,773,682 (GRCm39) A238T probably benign Het
Dnah6 T C 6: 73,121,752 (GRCm39) Y1410C probably damaging Het
Fam186a AGCCGCTGCCGCTGCCGCTGCCGC AGCCGCTGCCGCTGCCGC 15: 99,844,107 (GRCm39) probably benign Het
Farp2 T C 1: 93,488,910 (GRCm39) probably null Het
Galnt7 T G 8: 57,985,729 (GRCm39) D547A probably damaging Het
Gm1527 C A 3: 28,956,440 (GRCm39) D135E probably damaging Het
Grm5 T C 7: 87,723,747 (GRCm39) I679T probably damaging Het
Hectd4 C A 5: 121,467,619 (GRCm39) R2523S possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Htr1f A T 16: 64,746,637 (GRCm39) S218R probably damaging Het
Lrit1 G A 14: 36,776,891 (GRCm39) A4T unknown Het
Ly6f G T 15: 75,141,706 (GRCm39) D50Y probably damaging Het
Mafg GGTTCTTCAGTGT GGT 11: 120,520,415 (GRCm39) probably null Het
Map2 T A 1: 66,454,522 (GRCm39) Y1137* probably null Het
Map4k3 C A 17: 81,035,257 (GRCm39) R21L possibly damaging Het
Mapk10 A T 5: 103,186,442 (GRCm39) V90D probably damaging Het
Mapkapk3 T A 9: 107,136,067 (GRCm39) E219V probably damaging Het
Mideas T C 12: 84,199,327 (GRCm39) Y1040C probably damaging Het
Mos T G 4: 3,871,457 (GRCm39) I120L probably benign Het
Mrgprb4 A G 7: 47,848,679 (GRCm39) V83A probably benign Het
Mrnip A G 11: 50,065,768 (GRCm39) Q19R probably damaging Het
Myrip T C 9: 120,261,544 (GRCm39) S386P probably benign Het
Mzt2 A G 16: 15,666,568 (GRCm39) W141R probably benign Het
Ncam1 A G 9: 49,428,856 (GRCm39) Y710H probably damaging Het
Nlrp9c G T 7: 26,081,837 (GRCm39) L630I probably benign Het
Odad2 A T 18: 7,294,527 (GRCm39) S29T probably benign Het
Oplah C A 15: 76,189,876 (GRCm39) G150C probably benign Het
Or4c11b A G 2: 88,625,016 (GRCm39) T97A probably benign Het
Or51q1 A T 7: 103,628,581 (GRCm39) M61L probably damaging Het
Or52a20 G A 7: 103,366,737 (GRCm39) C312Y probably benign Het
Or6k2 A G 1: 173,986,369 (GRCm39) Q10R probably benign Het
Patl1 A G 19: 11,908,973 (GRCm39) K460R probably damaging Het
Pdgfrb A T 18: 61,179,100 (GRCm39) probably null Het
Phldb2 T C 16: 45,680,757 (GRCm39) I17V probably benign Het
Ppp3r1 A G 11: 17,144,789 (GRCm39) D134G probably damaging Het
Ppp4r4 C T 12: 103,570,315 (GRCm39) T763I probably benign Het
Prmt9 A G 8: 78,276,358 (GRCm39) D61G probably benign Het
Ptk2 T C 15: 73,131,457 (GRCm39) M589V possibly damaging Het
Rabl6 A G 2: 25,486,446 (GRCm39) W153R probably benign Het
Rb1cc1 A G 1: 6,319,109 (GRCm39) I843V Het
Resf1 T C 6: 149,230,368 (GRCm39) V1138A possibly damaging Het
Rnf19b A G 4: 128,977,940 (GRCm39) E719G Het
Sart3 T C 5: 113,892,410 (GRCm39) D363G possibly damaging Het
Sgo2a C A 1: 58,037,283 (GRCm39) D9E possibly damaging Het
Slc27a5 A G 7: 12,725,097 (GRCm39) V450A probably benign Het
Slc8b1 T A 5: 120,668,416 (GRCm39) Y483N probably damaging Het
Slco1b2 A G 6: 141,617,974 (GRCm39) T475A probably damaging Het
Slfn3 T C 11: 83,103,458 (GRCm39) F110L probably benign Het
Spata31e5 T C 1: 28,815,975 (GRCm39) I686V probably benign Het
Ssr2 T A 3: 88,495,269 (GRCm39) Y175N probably damaging Het
Tagap A T 17: 8,150,280 (GRCm39) N222Y probably damaging Het
Tecta C T 9: 42,278,479 (GRCm39) V1010M probably benign Het
Trim36 A T 18: 46,300,664 (GRCm39) I669N possibly damaging Het
Ubp1 A G 9: 113,799,319 (GRCm39) T425A probably benign Het
Vit G A 17: 78,934,278 (GRCm39) D627N probably damaging Het
Vmn2r59 A T 7: 41,695,884 (GRCm39) I176N probably benign Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 111,673,990 (GRCm39) missense probably benign 0.00
IGL00574:Usp47 APN 7 111,662,542 (GRCm39) missense probably damaging 1.00
IGL00975:Usp47 APN 7 111,692,577 (GRCm39) missense probably damaging 1.00
IGL01289:Usp47 APN 7 111,662,565 (GRCm39) missense probably damaging 1.00
IGL01419:Usp47 APN 7 111,687,118 (GRCm39) missense possibly damaging 0.94
IGL01645:Usp47 APN 7 111,654,069 (GRCm39) missense probably damaging 0.96
IGL01871:Usp47 APN 7 111,676,993 (GRCm39) splice site probably benign
IGL02066:Usp47 APN 7 111,663,604 (GRCm39) missense probably damaging 1.00
IGL02122:Usp47 APN 7 111,706,115 (GRCm39) missense probably damaging 0.97
IGL02153:Usp47 APN 7 111,703,256 (GRCm39) missense probably benign 0.00
IGL02550:Usp47 APN 7 111,703,561 (GRCm39) missense probably damaging 1.00
IGL02710:Usp47 APN 7 111,692,132 (GRCm39) missense probably benign 0.01
IGL02756:Usp47 APN 7 111,692,270 (GRCm39) missense possibly damaging 0.76
IGL03093:Usp47 APN 7 111,688,827 (GRCm39) missense probably damaging 1.00
IGL03398:Usp47 APN 7 111,673,710 (GRCm39) missense probably damaging 1.00
0152:Usp47 UTSW 7 111,655,784 (GRCm39) missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 111,703,548 (GRCm39) splice site probably benign
R0110:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0381:Usp47 UTSW 7 111,662,600 (GRCm39) critical splice donor site probably null
R0450:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0634:Usp47 UTSW 7 111,707,862 (GRCm39) missense probably damaging 1.00
R0881:Usp47 UTSW 7 111,690,643 (GRCm39) missense possibly damaging 0.51
R1178:Usp47 UTSW 7 111,709,205 (GRCm39) missense possibly damaging 0.68
R1447:Usp47 UTSW 7 111,673,775 (GRCm39) critical splice donor site probably null
R1640:Usp47 UTSW 7 111,682,334 (GRCm39) missense probably damaging 0.99
R1727:Usp47 UTSW 7 111,685,307 (GRCm39) missense probably damaging 0.96
R1866:Usp47 UTSW 7 111,701,077 (GRCm39) missense possibly damaging 0.93
R1876:Usp47 UTSW 7 111,654,127 (GRCm39) missense probably damaging 0.99
R1953:Usp47 UTSW 7 111,692,083 (GRCm39) missense probably benign 0.26
R2117:Usp47 UTSW 7 111,666,443 (GRCm39) critical splice donor site probably null
R2176:Usp47 UTSW 7 111,691,934 (GRCm39) missense probably benign 0.00
R2187:Usp47 UTSW 7 111,666,398 (GRCm39) missense probably damaging 1.00
R2504:Usp47 UTSW 7 111,703,677 (GRCm39) critical splice donor site probably null
R2902:Usp47 UTSW 7 111,692,658 (GRCm39) missense probably damaging 1.00
R2922:Usp47 UTSW 7 111,692,405 (GRCm39) missense probably damaging 1.00
R2939:Usp47 UTSW 7 111,681,743 (GRCm39) missense probably damaging 1.00
R4065:Usp47 UTSW 7 111,652,623 (GRCm39) missense probably benign 0.30
R4179:Usp47 UTSW 7 111,687,091 (GRCm39) missense probably damaging 1.00
R4235:Usp47 UTSW 7 111,709,255 (GRCm39) missense probably damaging 0.99
R4243:Usp47 UTSW 7 111,707,836 (GRCm39) missense probably damaging 1.00
R4281:Usp47 UTSW 7 111,709,200 (GRCm39) missense probably benign 0.03
R4360:Usp47 UTSW 7 111,654,139 (GRCm39) missense probably damaging 1.00
R4604:Usp47 UTSW 7 111,701,038 (GRCm39) missense probably damaging 1.00
R4857:Usp47 UTSW 7 111,681,759 (GRCm39) missense probably damaging 1.00
R5133:Usp47 UTSW 7 111,683,089 (GRCm39) missense probably damaging 1.00
R5179:Usp47 UTSW 7 111,692,639 (GRCm39) missense probably damaging 1.00
R5322:Usp47 UTSW 7 111,652,476 (GRCm39) missense probably damaging 0.99
R5445:Usp47 UTSW 7 111,673,928 (GRCm39) missense probably damaging 1.00
R5465:Usp47 UTSW 7 111,658,209 (GRCm39) missense probably damaging 1.00
R5699:Usp47 UTSW 7 111,709,204 (GRCm39) missense probably benign 0.00
R5961:Usp47 UTSW 7 111,652,523 (GRCm39) missense probably damaging 1.00
R6117:Usp47 UTSW 7 111,687,139 (GRCm39) missense probably damaging 0.98
R6271:Usp47 UTSW 7 111,686,263 (GRCm39) missense probably damaging 1.00
R7155:Usp47 UTSW 7 111,686,220 (GRCm39) missense probably damaging 0.97
R7229:Usp47 UTSW 7 111,692,084 (GRCm39) missense probably benign 0.04
R7246:Usp47 UTSW 7 111,715,116 (GRCm39)
R7285:Usp47 UTSW 7 111,692,315 (GRCm39) missense probably benign 0.02
R7938:Usp47 UTSW 7 111,687,132 (GRCm39) missense probably damaging 0.99
R8079:Usp47 UTSW 7 111,646,177 (GRCm39) missense probably damaging 1.00
R8114:Usp47 UTSW 7 111,692,394 (GRCm39) missense probably damaging 1.00
R8141:Usp47 UTSW 7 111,652,472 (GRCm39) missense possibly damaging 0.60
R8172:Usp47 UTSW 7 111,687,133 (GRCm39) nonsense probably null
R8223:Usp47 UTSW 7 111,703,583 (GRCm39) missense probably damaging 1.00
R8510:Usp47 UTSW 7 111,658,208 (GRCm39) missense probably damaging 1.00
R8701:Usp47 UTSW 7 111,692,402 (GRCm39) missense probably damaging 1.00
R9135:Usp47 UTSW 7 111,652,431 (GRCm39) missense probably benign 0.30
R9311:Usp47 UTSW 7 111,703,257 (GRCm39) missense probably benign 0.02
R9417:Usp47 UTSW 7 111,688,801 (GRCm39) missense possibly damaging 0.86
R9487:Usp47 UTSW 7 111,677,063 (GRCm39) missense probably damaging 0.99
R9628:Usp47 UTSW 7 111,705,999 (GRCm39) missense probably benign 0.01
RF010:Usp47 UTSW 7 111,692,145 (GRCm39) missense probably damaging 0.99
X0027:Usp47 UTSW 7 111,687,054 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTCATGTTACGTTACTCTG -3'
(R):5'- ATCAGGCTCAAGACTCCTAGC -3'

Sequencing Primer
(F):5'- GTCATGTTACGTTACTCTGTATCCAC -3'
(R):5'- TTGGAAACATGTAACAAGCTCTAC -3'
Posted On 2021-12-30