Incidental Mutation 'R9106:Myrip'
ID 692029
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9106 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120301513-120474841 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120432478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: S386P

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S386P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,328,870 V1138A possibly damaging Het
Ahctf1 C A 1: 179,787,036 K394N probably benign Het
Armc4 A T 18: 7,294,527 S29T probably benign Het
Banp A T 8: 121,978,633 T81S possibly damaging Het
Btn2a2 T C 13: 23,478,295 E495G probably benign Het
Cfap69 T C 5: 5,640,190 I158M possibly damaging Het
Cgnl1 C A 9: 71,721,591 probably benign Het
Clip1 T A 5: 123,615,160 Q186L probably damaging Het
Clspn G A 4: 126,577,450 probably benign Het
Cnst A G 1: 179,604,597 E224G probably damaging Het
Ctdsp1 T C 1: 74,394,725 L155P probably damaging Het
D5Ertd579e C T 5: 36,616,338 A238T probably benign Het
Dnah6 T C 6: 73,144,769 Y1410C probably damaging Het
Elmsan1 T C 12: 84,152,553 Y1040C probably damaging Het
Fam186a AGCCGCTGCCGCTGCCGCTGCCGC AGCCGCTGCCGCTGCCGC 15: 99,946,226 probably benign Het
Farp2 T C 1: 93,561,188 probably null Het
Galnt7 T G 8: 57,532,695 D547A probably damaging Het
Gm1527 C A 3: 28,902,291 D135E probably damaging Het
Gm597 T C 1: 28,776,894 I686V probably benign Het
Grm5 T C 7: 88,074,539 I679T probably damaging Het
Hectd4 C A 5: 121,329,556 R2523S possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Htr1f A T 16: 64,926,274 S218R probably damaging Het
Lrit1 G A 14: 37,054,934 A4T unknown Het
Ly6f G T 15: 75,269,857 D50Y probably damaging Het
Mafg GGTTCTTCAGTGT GGT 11: 120,629,589 probably null Het
Map2 T A 1: 66,415,363 Y1137* probably null Het
Map4k3 C A 17: 80,727,828 R21L possibly damaging Het
Mapk10 A T 5: 103,038,576 V90D probably damaging Het
Mapkapk3 T A 9: 107,258,868 E219V probably damaging Het
Mos T G 4: 3,871,457 I120L probably benign Het
Mrgprb4 A G 7: 48,198,931 V83A probably benign Het
Mrnip A G 11: 50,174,941 Q19R probably damaging Het
Mzt2 A G 16: 15,848,704 W141R probably benign Het
Ncam1 A G 9: 49,517,556 Y710H probably damaging Het
Nlrp9c G T 7: 26,382,412 L630I probably benign Het
Olfr1201 A G 2: 88,794,672 T97A probably benign Het
Olfr243 G A 7: 103,717,530 C312Y probably benign Het
Olfr420 A G 1: 174,158,803 Q10R probably benign Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Oplah C A 15: 76,305,676 G150C probably benign Het
Patl1 A G 19: 11,931,609 K460R probably damaging Het
Pdgfrb A T 18: 61,046,028 probably null Het
Phldb2 T C 16: 45,860,394 I17V probably benign Het
Ppp3r1 A G 11: 17,194,789 D134G probably damaging Het
Ppp4r4 C T 12: 103,604,056 T763I probably benign Het
Prmt9 A G 8: 77,549,729 D61G probably benign Het
Ptk2 T C 15: 73,259,608 M589V possibly damaging Het
Rabl6 A G 2: 25,596,434 W153R probably benign Het
Rb1cc1 A G 1: 6,248,885 I843V Het
Rnf19b A G 4: 129,084,147 E719G Het
Sart3 T C 5: 113,754,349 D363G possibly damaging Het
Sgo2a C A 1: 57,998,124 D9E possibly damaging Het
Slc27a5 A G 7: 12,991,170 V450A probably benign Het
Slc8b1 T A 5: 120,530,351 Y483N probably damaging Het
Slco1b2 A G 6: 141,672,248 T475A probably damaging Het
Slfn3 T C 11: 83,212,632 F110L probably benign Het
Ssr2 T A 3: 88,587,962 Y175N probably damaging Het
Tagap A T 17: 7,931,448 N222Y probably damaging Het
Tecta C T 9: 42,367,183 V1010M probably benign Het
Trim36 A T 18: 46,167,597 I669N possibly damaging Het
Ubp1 A G 9: 113,970,251 T425A probably benign Het
Usp47 T C 7: 112,082,506 I508T probably damaging Het
Vit G A 17: 78,626,849 D627N probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
R8204:Myrip UTSW 9 120432979 critical splice donor site probably null
R8557:Myrip UTSW 9 120417186 missense probably benign 0.32
R8853:Myrip UTSW 9 120461421 missense probably damaging 1.00
R8911:Myrip UTSW 9 120441418 missense possibly damaging 0.94
R9225:Myrip UTSW 9 120464784 missense probably damaging 0.97
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGATGACGTGTTACCCC -3'
(R):5'- TCTGAATCCGAGCACATGG -3'

Sequencing Primer
(F):5'- TCGCTCCTACAGTAATAATGGAC -3'
(R):5'- CACATGGCCTCAGGGTTTG -3'
Posted On 2021-12-30