Incidental Mutation 'R9106:Myrip'
ID 692029
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 068970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9106 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120261544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: S386P

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S386P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 C A 1: 179,614,601 (GRCm39) K394N probably benign Het
Banp A T 8: 122,705,372 (GRCm39) T81S possibly damaging Het
Btn2a2 T C 13: 23,662,465 (GRCm39) E495G probably benign Het
Cfap69 T C 5: 5,690,190 (GRCm39) I158M possibly damaging Het
Cgnl1 C A 9: 71,628,873 (GRCm39) probably benign Het
Clip1 T A 5: 123,753,223 (GRCm39) Q186L probably damaging Het
Clspn G A 4: 126,471,243 (GRCm39) probably benign Het
Cnst A G 1: 179,432,162 (GRCm39) E224G probably damaging Het
Ctdsp1 T C 1: 74,433,884 (GRCm39) L155P probably damaging Het
D5Ertd579e C T 5: 36,773,682 (GRCm39) A238T probably benign Het
Dnah6 T C 6: 73,121,752 (GRCm39) Y1410C probably damaging Het
Fam186a AGCCGCTGCCGCTGCCGCTGCCGC AGCCGCTGCCGCTGCCGC 15: 99,844,107 (GRCm39) probably benign Het
Farp2 T C 1: 93,488,910 (GRCm39) probably null Het
Galnt7 T G 8: 57,985,729 (GRCm39) D547A probably damaging Het
Gm1527 C A 3: 28,956,440 (GRCm39) D135E probably damaging Het
Grm5 T C 7: 87,723,747 (GRCm39) I679T probably damaging Het
Hectd4 C A 5: 121,467,619 (GRCm39) R2523S possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Htr1f A T 16: 64,746,637 (GRCm39) S218R probably damaging Het
Lrit1 G A 14: 36,776,891 (GRCm39) A4T unknown Het
Ly6f G T 15: 75,141,706 (GRCm39) D50Y probably damaging Het
Mafg GGTTCTTCAGTGT GGT 11: 120,520,415 (GRCm39) probably null Het
Map2 T A 1: 66,454,522 (GRCm39) Y1137* probably null Het
Map4k3 C A 17: 81,035,257 (GRCm39) R21L possibly damaging Het
Mapk10 A T 5: 103,186,442 (GRCm39) V90D probably damaging Het
Mapkapk3 T A 9: 107,136,067 (GRCm39) E219V probably damaging Het
Mideas T C 12: 84,199,327 (GRCm39) Y1040C probably damaging Het
Mos T G 4: 3,871,457 (GRCm39) I120L probably benign Het
Mrgprb4 A G 7: 47,848,679 (GRCm39) V83A probably benign Het
Mrnip A G 11: 50,065,768 (GRCm39) Q19R probably damaging Het
Mzt2 A G 16: 15,666,568 (GRCm39) W141R probably benign Het
Ncam1 A G 9: 49,428,856 (GRCm39) Y710H probably damaging Het
Nlrp9c G T 7: 26,081,837 (GRCm39) L630I probably benign Het
Odad2 A T 18: 7,294,527 (GRCm39) S29T probably benign Het
Oplah C A 15: 76,189,876 (GRCm39) G150C probably benign Het
Or4c11b A G 2: 88,625,016 (GRCm39) T97A probably benign Het
Or51q1 A T 7: 103,628,581 (GRCm39) M61L probably damaging Het
Or52a20 G A 7: 103,366,737 (GRCm39) C312Y probably benign Het
Or6k2 A G 1: 173,986,369 (GRCm39) Q10R probably benign Het
Patl1 A G 19: 11,908,973 (GRCm39) K460R probably damaging Het
Pdgfrb A T 18: 61,179,100 (GRCm39) probably null Het
Phldb2 T C 16: 45,680,757 (GRCm39) I17V probably benign Het
Ppp3r1 A G 11: 17,144,789 (GRCm39) D134G probably damaging Het
Ppp4r4 C T 12: 103,570,315 (GRCm39) T763I probably benign Het
Prmt9 A G 8: 78,276,358 (GRCm39) D61G probably benign Het
Ptk2 T C 15: 73,131,457 (GRCm39) M589V possibly damaging Het
Rabl6 A G 2: 25,486,446 (GRCm39) W153R probably benign Het
Rb1cc1 A G 1: 6,319,109 (GRCm39) I843V Het
Resf1 T C 6: 149,230,368 (GRCm39) V1138A possibly damaging Het
Rnf19b A G 4: 128,977,940 (GRCm39) E719G Het
Sart3 T C 5: 113,892,410 (GRCm39) D363G possibly damaging Het
Sgo2a C A 1: 58,037,283 (GRCm39) D9E possibly damaging Het
Slc27a5 A G 7: 12,725,097 (GRCm39) V450A probably benign Het
Slc8b1 T A 5: 120,668,416 (GRCm39) Y483N probably damaging Het
Slco1b2 A G 6: 141,617,974 (GRCm39) T475A probably damaging Het
Slfn3 T C 11: 83,103,458 (GRCm39) F110L probably benign Het
Spata31e5 T C 1: 28,815,975 (GRCm39) I686V probably benign Het
Ssr2 T A 3: 88,495,269 (GRCm39) Y175N probably damaging Het
Tagap A T 17: 8,150,280 (GRCm39) N222Y probably damaging Het
Tecta C T 9: 42,278,479 (GRCm39) V1010M probably benign Het
Trim36 A T 18: 46,300,664 (GRCm39) I669N possibly damaging Het
Ubp1 A G 9: 113,799,319 (GRCm39) T425A probably benign Het
Usp47 T C 7: 111,681,713 (GRCm39) I508T probably damaging Het
Vit G A 17: 78,934,278 (GRCm39) D627N probably damaging Het
Vmn2r59 A T 7: 41,695,884 (GRCm39) I176N probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGAGATGACGTGTTACCCC -3'
(R):5'- TCTGAATCCGAGCACATGG -3'

Sequencing Primer
(F):5'- TCGCTCCTACAGTAATAATGGAC -3'
(R):5'- CACATGGCCTCAGGGTTTG -3'
Posted On 2021-12-30