Incidental Mutation 'R9108:Adamts9'
ID 692073
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms Mhdaund3, Mhdaund4, 1810011L16Rik, 8430403M15Rik, E030027K14Rik, Gsfund3, UND3, UND4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 92749680-92920473 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 92857721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 856 (V856M)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113434] [ENSMUST00000113438] [ENSMUST00000167391]
AlphaFold E9PUN6
Predicted Effect probably benign
Transcript: ENSMUST00000113434
Predicted Effect probably damaging
Transcript: ENSMUST00000113438
AA Change: V856M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V856M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167391
AA Change: V275M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: V275M

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 (GRCm39) V398M probably benign Het
4930568D16Rik G A 2: 35,244,942 (GRCm39) P137S probably damaging Het
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Abcg8 A C 17: 85,000,243 (GRCm39) I268L probably benign Het
Acvrl1 A G 15: 101,039,038 (GRCm39) Q445R probably damaging Het
Adam17 T C 12: 21,380,132 (GRCm39) N625D probably benign Het
Adar T C 3: 89,643,474 (GRCm39) C452R probably damaging Het
Adgra3 G T 5: 50,136,295 (GRCm39) A730D probably damaging Het
Adnp2 C T 18: 80,185,925 (GRCm39) R16Q probably damaging Het
Aox1 T C 1: 58,321,851 (GRCm39) C48R probably damaging Het
Cabin1 T C 10: 75,492,973 (GRCm39) E1774G possibly damaging Het
Capsl A T 15: 9,465,910 (GRCm39) I199F possibly damaging Het
Ccdc191 T A 16: 43,718,512 (GRCm39) D36E possibly damaging Het
Cep170 T A 1: 176,616,051 (GRCm39) K86* probably null Het
Cnnm1 T C 19: 43,464,649 (GRCm39) F736S possibly damaging Het
Col11a2 T A 17: 34,276,634 (GRCm39) V532E probably benign Het
Dnmt3l T C 10: 77,892,756 (GRCm39) probably null Het
Dync1h1 T A 12: 110,622,706 (GRCm39) probably benign Het
Dzank1 C A 2: 144,364,391 (GRCm39) V69L probably benign Het
Epor T G 9: 21,870,875 (GRCm39) E335A probably damaging Het
Fbxo46 A T 7: 18,870,308 (GRCm39) Y309F probably damaging Het
Fra10ac1 A T 19: 38,202,779 (GRCm39) probably benign Het
Gid8 G T 2: 180,352,132 (GRCm39) probably benign Het
Gm57858 T G 3: 36,080,036 (GRCm39) *240C probably null Het
Gnptab C T 10: 88,269,400 (GRCm39) S701L Het
Ifnl3 T C 7: 28,223,704 (GRCm39) L180P probably benign Het
Ikzf2 T A 1: 69,577,956 (GRCm39) I518F probably damaging Het
Ildr1 A G 16: 36,535,919 (GRCm39) T145A probably benign Het
Kiss1r A T 10: 79,754,336 (GRCm39) probably benign Het
Lhpp A G 7: 132,252,018 (GRCm39) D219G probably damaging Het
Lrp1 A T 10: 127,390,206 (GRCm39) M3071K probably damaging Het
Map6 T C 7: 98,986,103 (GRCm39) L872P probably damaging Het
Mgst2 T A 3: 51,589,233 (GRCm39) L82Q probably damaging Het
Mier2 A T 10: 79,377,756 (GRCm39) V399E probably benign Het
Nms T C 1: 38,985,147 (GRCm39) V91A possibly damaging Het
Nt5dc2 T A 14: 30,857,016 (GRCm39) Y145* probably null Het
Olfml2a A T 2: 38,831,753 (GRCm39) M111L probably benign Het
Or5p63 T C 7: 107,810,846 (GRCm39) N297D probably damaging Het
Or5p75-ps1 T A 7: 108,107,779 (GRCm39) L172Q unknown Het
Plod3 T C 5: 137,018,017 (GRCm39) I221T probably damaging Het
Polm T C 11: 5,779,872 (GRCm39) Q342R probably benign Het
Ppp2r5c A T 12: 110,521,303 (GRCm39) L275F probably damaging Het
Prdm12 C T 2: 31,533,929 (GRCm39) T182M possibly damaging Het
Rasgrp2 G A 19: 6,458,890 (GRCm39) V440M probably damaging Het
Rnf111 C T 9: 70,336,846 (GRCm39) G947D probably damaging Het
Runx3 A T 4: 134,882,692 (GRCm39) M143L probably damaging Het
Samd9l T C 6: 3,373,104 (GRCm39) S1386G possibly damaging Het
Saxo2 C T 7: 82,284,082 (GRCm39) V259I probably benign Het
Shroom3 T C 5: 93,087,975 (GRCm39) S242P probably damaging Het
Slc35e1 G A 8: 73,246,030 (GRCm39) P134L Het
Spata31d1a A G 13: 59,850,982 (GRCm39) V382A probably benign Het
Tanc2 T A 11: 105,810,580 (GRCm39) probably benign Het
Tenm3 A T 8: 48,766,271 (GRCm39) probably null Het
Trip10 C T 17: 57,560,519 (GRCm39) A123V probably damaging Het
Trmt13 A G 3: 116,375,129 (GRCm39) S460P probably damaging Het
Trpd52l3 A G 19: 29,981,329 (GRCm39) N28S probably benign Het
Tubb4a A G 17: 57,388,232 (GRCm39) F265L probably benign Het
Uba6 A T 5: 86,282,934 (GRCm39) C581S possibly damaging Het
Uckl1 A G 2: 181,211,293 (GRCm39) V512A probably damaging Het
Usp34 A T 11: 23,320,528 (GRCm39) M957L Het
Vmn2r57 T C 7: 41,078,192 (GRCm39) I89V possibly damaging Het
Zfp1005 T A 2: 150,109,969 (GRCm39) C220S possibly damaging Het
Zfp322a T C 13: 23,541,437 (GRCm39) I102V probably benign Het
Zzef1 A G 11: 72,790,604 (GRCm39) D2186G probably benign Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92,836,883 (GRCm39) missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92,837,155 (GRCm39) missense probably benign 0.00
IGL01462:Adamts9 APN 6 92,871,247 (GRCm39) missense probably benign 0.04
IGL01551:Adamts9 APN 6 92,784,001 (GRCm39) missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92,835,128 (GRCm39) splice site probably benign
IGL01638:Adamts9 APN 6 92,849,409 (GRCm39) missense probably benign 0.19
IGL01757:Adamts9 APN 6 92,773,140 (GRCm39) missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92,754,420 (GRCm39) missense probably benign 0.00
IGL02379:Adamts9 APN 6 92,774,014 (GRCm39) missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92,773,978 (GRCm39) missense probably benign 0.04
IGL02554:Adamts9 APN 6 92,857,828 (GRCm39) missense probably benign 0.01
IGL02832:Adamts9 APN 6 92,784,156 (GRCm39) missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92,866,918 (GRCm39) missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92,864,413 (GRCm39) nonsense probably null
IGL03401:Adamts9 APN 6 92,763,849 (GRCm39) missense probably damaging 0.97
basilisk UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
bluebeard UTSW 6 92,856,940 (GRCm39) nonsense probably null
Serpent UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
PIT4402001:Adamts9 UTSW 6 92,849,328 (GRCm39) missense probably benign
PIT4458001:Adamts9 UTSW 6 92,866,886 (GRCm39) missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0067:Adamts9 UTSW 6 92,867,148 (GRCm39) missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92,920,066 (GRCm39) missense probably benign
R0326:Adamts9 UTSW 6 92,835,038 (GRCm39) nonsense probably null
R0396:Adamts9 UTSW 6 92,774,986 (GRCm39) missense probably benign 0.00
R0490:Adamts9 UTSW 6 92,849,847 (GRCm39) missense probably benign
R0504:Adamts9 UTSW 6 92,889,626 (GRCm39) missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92,835,094 (GRCm39) missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92,857,938 (GRCm39) missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92,880,783 (GRCm39) missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92,773,414 (GRCm39) missense probably benign
R1433:Adamts9 UTSW 6 92,826,271 (GRCm39) critical splice donor site probably null
R1558:Adamts9 UTSW 6 92,885,692 (GRCm39) missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92,857,604 (GRCm39) missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92,840,357 (GRCm39) missense probably benign 0.27
R1855:Adamts9 UTSW 6 92,878,350 (GRCm39) splice site probably benign
R1887:Adamts9 UTSW 6 92,849,769 (GRCm39) critical splice donor site probably null
R1934:Adamts9 UTSW 6 92,920,102 (GRCm39) missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92,836,830 (GRCm39) missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92,773,375 (GRCm39) missense probably benign
R2370:Adamts9 UTSW 6 92,837,184 (GRCm39) missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92,889,812 (GRCm39) missense probably benign
R2432:Adamts9 UTSW 6 92,834,881 (GRCm39) missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92,772,891 (GRCm39) splice site probably benign
R3015:Adamts9 UTSW 6 92,849,913 (GRCm39) missense probably benign 0.05
R3611:Adamts9 UTSW 6 92,846,965 (GRCm39) missense probably benign 0.05
R4024:Adamts9 UTSW 6 92,849,765 (GRCm39) splice site probably benign
R4292:Adamts9 UTSW 6 92,772,977 (GRCm39) missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92,836,845 (GRCm39) missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92,856,940 (GRCm39) nonsense probably null
R4677:Adamts9 UTSW 6 92,793,587 (GRCm39) start codon destroyed probably null
R5114:Adamts9 UTSW 6 92,867,254 (GRCm39) missense probably benign 0.03
R5260:Adamts9 UTSW 6 92,784,118 (GRCm39) missense probably benign 0.00
R5384:Adamts9 UTSW 6 92,774,999 (GRCm39) missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92,857,678 (GRCm39) missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92,831,346 (GRCm39) missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92,775,114 (GRCm39) missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92,880,767 (GRCm39) missense probably benign 0.02
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92,867,099 (GRCm39) missense probably damaging 1.00
R6051:Adamts9 UTSW 6 92,836,907 (GRCm39) missense possibly damaging 0.83
R6082:Adamts9 UTSW 6 92,866,930 (GRCm39) missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92,774,002 (GRCm39) missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92,867,101 (GRCm39) missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92,849,316 (GRCm39) missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92,882,172 (GRCm39) missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92,840,335 (GRCm39) missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92,886,774 (GRCm39) nonsense probably null
R7095:Adamts9 UTSW 6 92,864,672 (GRCm39) missense probably benign 0.39
R7287:Adamts9 UTSW 6 92,866,984 (GRCm39) missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92,871,270 (GRCm39) missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92,835,102 (GRCm39) missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92,914,319 (GRCm39) missense probably benign 0.00
R7682:Adamts9 UTSW 6 92,857,679 (GRCm39) missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92,773,219 (GRCm39) missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92,849,366 (GRCm39) missense probably benign 0.00
R7851:Adamts9 UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
R7974:Adamts9 UTSW 6 92,886,668 (GRCm39) critical splice donor site probably null
R8224:Adamts9 UTSW 6 92,773,351 (GRCm39) missense probably damaging 0.96
R8328:Adamts9 UTSW 6 92,866,993 (GRCm39) missense probably benign 0.17
R8334:Adamts9 UTSW 6 92,914,225 (GRCm39) splice site probably null
R8559:Adamts9 UTSW 6 92,784,117 (GRCm39) missense probably benign 0.01
R8709:Adamts9 UTSW 6 92,784,144 (GRCm39) missense probably damaging 1.00
R8735:Adamts9 UTSW 6 92,837,048 (GRCm39) intron probably benign
R8739:Adamts9 UTSW 6 92,831,261 (GRCm39) missense probably benign 0.04
R9171:Adamts9 UTSW 6 92,849,381 (GRCm39) missense probably benign 0.03
R9198:Adamts9 UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
R9299:Adamts9 UTSW 6 92,773,976 (GRCm39) missense probably benign 0.00
R9300:Adamts9 UTSW 6 92,864,371 (GRCm39) missense probably benign 0.10
R9308:Adamts9 UTSW 6 92,857,875 (GRCm39) missense probably benign 0.03
R9325:Adamts9 UTSW 6 92,849,279 (GRCm39) missense probably benign 0.00
R9397:Adamts9 UTSW 6 92,878,444 (GRCm39) missense probably damaging 1.00
R9550:Adamts9 UTSW 6 92,878,429 (GRCm39) missense probably benign 0.00
R9623:Adamts9 UTSW 6 92,857,661 (GRCm39) missense probably benign 0.02
R9698:Adamts9 UTSW 6 92,784,121 (GRCm39) missense probably damaging 1.00
R9755:Adamts9 UTSW 6 92,856,922 (GRCm39) missense probably benign 0.15
RF013:Adamts9 UTSW 6 92,920,126 (GRCm39) missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92,831,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAACAGAGCCCCTCATG -3'
(R):5'- GTTGTCTCCATGTCCAAAAGG -3'

Sequencing Primer
(F):5'- AGAGCCCCTCATGCCTACG -3'
(R):5'- AGCGCCGTCATTGAGTACAG -3'
Posted On 2021-12-30