Incidental Mutation 'R9108:Dnmt3l'
ID 692087
Institutional Source Beutler Lab
Gene Symbol Dnmt3l
Ensembl Gene ENSMUSG00000000730
Gene Name DNA (cytosine-5-)-methyltransferase 3-like
Synonyms D6Ertd14e, ecat7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 78041947-78063622 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 78056922 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]
AlphaFold Q9CWR8
Predicted Effect probably null
Transcript: ENSMUST00000000746
SMART Domains Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123940
SMART Domains Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131825
SMART Domains Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138785
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139539
SMART Domains Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151242
SMART Domains Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 V398M probably benign Het
4930568D16Rik G A 2: 35,354,930 P137S probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abcg8 A C 17: 84,692,815 I268L probably benign Het
Acvrl1 A G 15: 101,141,157 Q445R probably damaging Het
Adam17 T C 12: 21,330,131 N625D probably benign Het
Adamts9 C T 6: 92,880,740 V856M probably damaging Het
Adar T C 3: 89,736,167 C452R probably damaging Het
Adgra3 G T 5: 49,978,953 A730D probably damaging Het
Adnp2 C T 18: 80,142,710 R16Q probably damaging Het
Aox2 T C 1: 58,282,692 C48R probably damaging Het
Cabin1 T C 10: 75,657,139 E1774G possibly damaging Het
Capsl A T 15: 9,465,824 I199F possibly damaging Het
Ccdc191 T A 16: 43,898,149 D36E possibly damaging Het
Cep170 T A 1: 176,788,485 K86* probably null Het
Cnnm1 T C 19: 43,476,210 F736S possibly damaging Het
Col11a2 T A 17: 34,057,660 V532E probably benign Het
Dzank1 C A 2: 144,522,471 V69L probably benign Het
Epor T G 9: 21,959,579 E335A probably damaging Het
Fbxo46 A T 7: 19,136,383 Y309F probably damaging Het
Gm14124 T A 2: 150,268,049 C220S possibly damaging Het
Gnptab C T 10: 88,433,538 S701L Het
Ifnl3 T C 7: 28,524,279 L180P probably benign Het
Ikzf2 T A 1: 69,538,797 I518F probably damaging Het
Ildr1 A G 16: 36,715,557 T145A probably benign Het
Kiss1r A T 10: 79,918,502 probably benign Het
Lhpp A G 7: 132,650,289 D219G probably damaging Het
Lrp1 A T 10: 127,554,337 M3071K probably damaging Het
Map6 T C 7: 99,336,896 L872P probably damaging Het
Mgst2 T A 3: 51,681,812 L82Q probably damaging Het
Mier2 A T 10: 79,541,922 V399E probably benign Het
Nms T C 1: 38,946,066 V91A possibly damaging Het
Nt5dc2 T A 14: 31,135,059 Y145* probably null Het
Olfml2a A T 2: 38,941,741 M111L probably benign Het
Olfr487 T C 7: 108,211,639 N297D probably damaging Het
Olfr501-ps1 T A 7: 108,508,572 L172Q unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plod3 T C 5: 136,989,163 I221T probably damaging Het
Polm T C 11: 5,829,872 Q342R probably benign Het
Ppp2r5c A T 12: 110,554,869 L275F probably damaging Het
Prdm12 C T 2: 31,643,917 T182M possibly damaging Het
Rasgrp2 G A 19: 6,408,860 V440M probably damaging Het
Rnf111 C T 9: 70,429,564 G947D probably damaging Het
Runx3 A T 4: 135,155,381 M143L probably damaging Het
Samd9l T C 6: 3,373,104 S1386G possibly damaging Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Shroom3 T C 5: 92,940,116 S242P probably damaging Het
Slc35e1 G A 8: 72,492,186 P134L Het
Spata31d1a A G 13: 59,703,168 V382A probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Trip10 C T 17: 57,253,519 A123V probably damaging Het
Trmt13 A G 3: 116,581,480 S460P probably damaging Het
Trpd52l3 A G 19: 30,003,929 N28S probably benign Het
Tubb4a A G 17: 57,081,232 F265L probably benign Het
Uba6 A T 5: 86,135,075 C581S possibly damaging Het
Uckl1 A G 2: 181,569,500 V512A probably damaging Het
Usp34 A T 11: 23,370,528 M957L Het
Vmn2r57 T C 7: 41,428,768 I89V possibly damaging Het
Zfp322a T C 13: 23,357,267 I102V probably benign Het
Zzef1 A G 11: 72,899,778 D2186G probably benign Het
Other mutations in Dnmt3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnmt3l APN 10 78057355 missense probably damaging 1.00
IGL00827:Dnmt3l APN 10 78053996 missense probably damaging 1.00
IGL01072:Dnmt3l APN 10 78052771 missense probably benign 0.09
IGL01118:Dnmt3l APN 10 78057286 missense probably damaging 0.97
IGL01553:Dnmt3l APN 10 78063248 missense probably benign 0.00
IGL02322:Dnmt3l APN 10 78052738 missense possibly damaging 0.90
IGL02323:Dnmt3l APN 10 78063318 missense probably damaging 1.00
IGL02618:Dnmt3l APN 10 78054022 splice site probably benign
IGL02701:Dnmt3l APN 10 78055022 missense probably benign 0.01
IGL02950:Dnmt3l APN 10 78050951 missense probably benign 0.01
R0318:Dnmt3l UTSW 10 78055055 missense probably damaging 1.00
R0384:Dnmt3l UTSW 10 78052737 missense possibly damaging 0.95
R0391:Dnmt3l UTSW 10 78051916 splice site probably benign
R1144:Dnmt3l UTSW 10 78051905 missense probably damaging 1.00
R2069:Dnmt3l UTSW 10 78052732 missense probably damaging 1.00
R2115:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2116:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2117:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R4812:Dnmt3l UTSW 10 78057294 missense probably benign 0.06
R5001:Dnmt3l UTSW 10 78059731 missense probably null 1.00
R5039:Dnmt3l UTSW 10 78052900 splice site probably null
R5389:Dnmt3l UTSW 10 78056831 splice site probably null
R5799:Dnmt3l UTSW 10 78052026 missense possibly damaging 0.71
R5811:Dnmt3l UTSW 10 78052095 missense possibly damaging 0.78
R5875:Dnmt3l UTSW 10 78053938 missense probably benign
R6314:Dnmt3l UTSW 10 78059687 missense probably benign 0.00
R6537:Dnmt3l UTSW 10 78052064 missense probably null 1.00
R8437:Dnmt3l UTSW 10 78052768 missense possibly damaging 0.94
R9171:Dnmt3l UTSW 10 78059684 missense probably benign
R9205:Dnmt3l UTSW 10 78056752 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTAGGAGGTCTGTCTGGG -3'
(R):5'- AAGTTCACCTGGCAGTTAAGAGC -3'

Sequencing Primer
(F):5'- AGGTCTGTCTGGGTCACC -3'
(R):5'- GGCAGTTAAGAGCCCAGG -3'
Posted On 2021-12-30