Incidental Mutation 'R9108:Ildr1'
ID 692102
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36693978-36726804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36715557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000023617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect probably benign
Transcript: ENSMUST00000023617
AA Change: T145A

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089618
AA Change: T145A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119464
AA Change: T145A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 V398M probably benign Het
4930568D16Rik G A 2: 35,354,930 P137S probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abcg8 A C 17: 84,692,815 I268L probably benign Het
Acvrl1 A G 15: 101,141,157 Q445R probably damaging Het
Adam17 T C 12: 21,330,131 N625D probably benign Het
Adamts9 C T 6: 92,880,740 V856M probably damaging Het
Adar T C 3: 89,736,167 C452R probably damaging Het
Adgra3 G T 5: 49,978,953 A730D probably damaging Het
Adnp2 C T 18: 80,142,710 R16Q probably damaging Het
Aox2 T C 1: 58,282,692 C48R probably damaging Het
Cabin1 T C 10: 75,657,139 E1774G possibly damaging Het
Capsl A T 15: 9,465,824 I199F possibly damaging Het
Ccdc191 T A 16: 43,898,149 D36E possibly damaging Het
Cep170 T A 1: 176,788,485 K86* probably null Het
Cnnm1 T C 19: 43,476,210 F736S possibly damaging Het
Col11a2 T A 17: 34,057,660 V532E probably benign Het
Dnmt3l T C 10: 78,056,922 probably null Het
Dzank1 C A 2: 144,522,471 V69L probably benign Het
Epor T G 9: 21,959,579 E335A probably damaging Het
Fbxo46 A T 7: 19,136,383 Y309F probably damaging Het
Gm14124 T A 2: 150,268,049 C220S possibly damaging Het
Gnptab C T 10: 88,433,538 S701L Het
Ifnl3 T C 7: 28,524,279 L180P probably benign Het
Ikzf2 T A 1: 69,538,797 I518F probably damaging Het
Kiss1r A T 10: 79,918,502 probably benign Het
Lhpp A G 7: 132,650,289 D219G probably damaging Het
Lrp1 A T 10: 127,554,337 M3071K probably damaging Het
Map6 T C 7: 99,336,896 L872P probably damaging Het
Mgst2 T A 3: 51,681,812 L82Q probably damaging Het
Mier2 A T 10: 79,541,922 V399E probably benign Het
Nms T C 1: 38,946,066 V91A possibly damaging Het
Nt5dc2 T A 14: 31,135,059 Y145* probably null Het
Olfml2a A T 2: 38,941,741 M111L probably benign Het
Olfr487 T C 7: 108,211,639 N297D probably damaging Het
Olfr501-ps1 T A 7: 108,508,572 L172Q unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plod3 T C 5: 136,989,163 I221T probably damaging Het
Polm T C 11: 5,829,872 Q342R probably benign Het
Ppp2r5c A T 12: 110,554,869 L275F probably damaging Het
Prdm12 C T 2: 31,643,917 T182M possibly damaging Het
Rasgrp2 G A 19: 6,408,860 V440M probably damaging Het
Rnf111 C T 9: 70,429,564 G947D probably damaging Het
Runx3 A T 4: 135,155,381 M143L probably damaging Het
Samd9l T C 6: 3,373,104 S1386G possibly damaging Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Shroom3 T C 5: 92,940,116 S242P probably damaging Het
Slc35e1 G A 8: 72,492,186 P134L Het
Spata31d1a A G 13: 59,703,168 V382A probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Trip10 C T 17: 57,253,519 A123V probably damaging Het
Trmt13 A G 3: 116,581,480 S460P probably damaging Het
Trpd52l3 A G 19: 30,003,929 N28S probably benign Het
Tubb4a A G 17: 57,081,232 F265L probably benign Het
Uba6 A T 5: 86,135,075 C581S possibly damaging Het
Uckl1 A G 2: 181,569,500 V512A probably damaging Het
Usp34 A T 11: 23,370,528 M957L Het
Vmn2r57 T C 7: 41,428,768 I89V possibly damaging Het
Zfp322a T C 13: 23,357,267 I102V probably benign Het
Zzef1 A G 11: 72,899,778 D2186G probably benign Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36722350 missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36716164 missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36709477 critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36708319 missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36708336 missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36716206 missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36725541 missense probably damaging 0.97
R2110:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R2111:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36722021 missense probably benign 0.00
R4798:Ildr1 UTSW 16 36722555 missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36708298 missense probably benign 0.10
R5014:Ildr1 UTSW 16 36721559 missense probably damaging 0.98
R5426:Ildr1 UTSW 16 36709619 missense probably damaging 1.00
R5957:Ildr1 UTSW 16 36725534 makesense probably null
R7058:Ildr1 UTSW 16 36722368 missense probably benign 0.01
R7646:Ildr1 UTSW 16 36721919 missense possibly damaging 0.78
R8245:Ildr1 UTSW 16 36709521 missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36722358 nonsense probably null
R8392:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R8748:Ildr1 UTSW 16 36722372 missense probably benign 0.18
R8791:Ildr1 UTSW 16 36708400 missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36715548 missense probably damaging 1.00
R9252:Ildr1 UTSW 16 36716212 missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36709500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATCTCGGACCCCTTTGTC -3'
(R):5'- GTAAGGCCTAGTGACACACTG -3'

Sequencing Primer
(F):5'- CATCTACCACAGGCCTTCTTAGAAAG -3'
(R):5'- CTCTAGTAAGAGGCCATCAGAGGTC -3'
Posted On 2021-12-30