Incidental Mutation 'R9109:Kdm5b'
ID 692113
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 068918-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R9109 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 134528493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably null
Transcript: ENSMUST00000047714
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112198
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C A 8: 73,198,923 (GRCm39) A110D probably benign Het
4930407I10Rik A G 15: 81,947,615 (GRCm39) E504G probably benign Het
4931406B18Rik C A 7: 43,148,702 (GRCm39) A170S Het
Apbb2 T C 5: 66,609,018 (GRCm39) K210E probably benign Het
Arid4a C A 12: 71,122,129 (GRCm39) L515I probably damaging Het
Atp13a3 A G 16: 30,134,716 (GRCm39) S1186P possibly damaging Het
Brf1 A G 12: 112,927,011 (GRCm39) Y500H probably damaging Het
Btaf1 A G 19: 36,964,114 (GRCm39) Y895C probably benign Het
Cdhr17 T A 5: 16,997,909 (GRCm39) V47E possibly damaging Het
Cenpf T C 1: 189,391,571 (GRCm39) T737A probably benign Het
Cmklr1 G C 5: 113,752,043 (GRCm39) H319Q probably benign Het
Col18a1 G A 10: 76,893,204 (GRCm39) T1057M probably damaging Het
Col1a2 T A 6: 4,515,260 (GRCm39) probably null Het
Csmd3 A C 15: 47,617,187 (GRCm39) H1000Q Het
Cyp4a29 T A 4: 115,108,395 (GRCm39) M373K probably damaging Het
Dnhd1 A G 7: 105,333,173 (GRCm39) E215G probably damaging Het
Dusp19 T C 2: 80,447,729 (GRCm39) M1T probably null Het
Etv4 A G 11: 101,664,492 (GRCm39) Y253H probably benign Het
Exosc6 G A 8: 111,783,513 (GRCm39) A171T probably damaging Het
Fam219a G A 4: 41,521,870 (GRCm39) T70M probably damaging Het
Fau G A 19: 6,108,297 (GRCm39) R6H probably benign Het
Flrt3 T C 2: 140,501,879 (GRCm39) D583G probably damaging Het
Gm14443 A T 2: 175,011,869 (GRCm39) C192* probably null Het
Gm4353 T A 7: 115,682,843 (GRCm39) N246I probably benign Het
Igfn1 A G 1: 135,926,327 (GRCm39) L41P probably benign Het
Jakmip3 A T 7: 138,622,560 (GRCm39) I307F probably damaging Het
Kcnt2 T A 1: 140,353,035 (GRCm39) V248D probably damaging Het
Kctd14 A G 7: 97,107,243 (GRCm39) K166R probably benign Het
Kif5c A G 2: 49,620,151 (GRCm39) D461G probably damaging Het
Lpin2 T C 17: 71,538,516 (GRCm39) probably null Het
Mettl22 G A 16: 8,305,231 (GRCm39) D295N probably damaging Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Or10a5 A T 7: 106,635,640 (GRCm39) I93F probably damaging Het
Or5b95 T A 19: 12,658,190 (GRCm39) C239* probably null Het
Or5k8 A T 16: 58,644,677 (GRCm39) Y132N probably damaging Het
Pecam1 G T 11: 106,586,587 (GRCm39) N309K probably damaging Het
Pigc C T 1: 161,798,032 (GRCm39) R5C probably benign Het
Pih1d1 T C 7: 44,809,193 (GRCm39) V259A possibly damaging Het
Ptpre A G 7: 135,271,508 (GRCm39) I374M probably benign Het
Rnps1 A G 17: 24,637,573 (GRCm39) S72G unknown Het
S100pbp A G 4: 129,044,847 (GRCm39) Y363H probably damaging Het
Sema5a A G 15: 32,619,040 (GRCm39) T523A probably benign Het
Slc38a8 A G 8: 120,212,851 (GRCm39) F270S possibly damaging Het
Slc4a1ap T C 5: 31,693,538 (GRCm39) S491P probably damaging Het
Slc66a2 T C 18: 80,300,300 (GRCm39) L57P probably damaging Het
Slc7a6 T C 8: 106,922,534 (GRCm39) V440A probably damaging Het
Sobp A T 10: 42,898,902 (GRCm39) C228S probably damaging Het
Sox8 T C 17: 25,787,813 (GRCm39) D212G possibly damaging Het
Specc1 A G 11: 62,102,464 (GRCm39) probably null Het
Svop G A 5: 114,168,231 (GRCm39) T456M probably benign Het
Synrg A G 11: 83,900,278 (GRCm39) D750G probably damaging Het
Syt14 C A 1: 192,612,944 (GRCm39) E336* probably null Het
Tcp10c A T 17: 13,576,650 (GRCm39) Q76H probably damaging Het
Tcp11l1 C T 2: 104,528,897 (GRCm39) V134I possibly damaging Het
Tex51 T C 18: 32,594,029 (GRCm39) R110G possibly damaging Het
Tle3 T A 9: 61,319,562 (GRCm39) H443Q possibly damaging Het
Unc13a C T 8: 72,108,335 (GRCm39) R506Q possibly damaging Het
Vmn2r27 T C 6: 124,174,224 (GRCm39) Y542C possibly damaging Het
Vmn2r5 T G 3: 64,411,411 (GRCm39) N386H possibly damaging Het
Vmn2r91 A G 17: 18,327,905 (GRCm39) I500V probably damaging Het
Wdfy4 A T 14: 32,760,704 (GRCm39) probably null Het
Zfp709 A T 8: 72,644,648 (GRCm39) E692D possibly damaging Het
Zglp1 A T 9: 20,977,482 (GRCm39) L111Q probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134,552,497 (GRCm39) missense probably benign
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTCATTTGAAAGTGTCACCTGG -3'
(R):5'- AGTCCATGTGTGCTAGTGGC -3'

Sequencing Primer
(F):5'- GTGTCACCTGGAAAACAGCTTTTC -3'
(R):5'- AGTGAATTCCAGGCTGACTGC -3'
Posted On 2021-12-30