Mutagenetix > Incidental Mutation

Incidental Mutation 'R9111:Secisbp2l'

692235

Institutional Source

Beutler Lab

Gene Symbol

Secisbp2l

Ensembl Gene

ENSMUSG00000035093

Gene Name

SECIS binding protein 2-like

Synonyms

3110001I20Rik

MMRRC Submission

068971-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.769) question?

Stock #

R9111 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125578906-125624790 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125602206 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 385 (S385P)

Ref Sequence

ENSEMBL: ENSMUSP00000055772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053699]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053699
AA Change: S385P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: S385P

Domain	Start	End	E-Value	Type
low complexity region	441	459	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	700	802	7.6e-24	PFAM
low complexity region	821	831	N/A	INTRINSIC
low complexity region	970	978	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093
AA Change: S10P

Domain	Start	End	E-Value	Type
low complexity region	67	85	N/A	INTRINSIC
low complexity region	181	194	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	326	427	3.5e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	T	C	8: 124,696,646 (GRCm39)	N210S		Het
Adamts17	A	G	7: 66,489,648 (GRCm39)	D22G	probably damaging	Het
Aldh3b1	T	C	19: 3,971,797 (GRCm39)	E58G	probably damaging	Het
Atg2a	G	A	19: 6,311,534 (GRCm39)	A1830T	probably damaging	Het
Birc6	T	C	17: 74,966,340 (GRCm39)	V4118A	probably damaging	Het
Ccdc28a	G	A	10: 18,100,750 (GRCm39)	P73S	possibly damaging	Het
Cdc42bpb	A	T	12: 111,284,903 (GRCm39)	D771E	probably benign	Het
Cdk14	G	A	5: 5,315,985 (GRCm39)	P13S	possibly damaging	Het
Cdr2	G	A	7: 120,559,345 (GRCm39)	S158F	possibly damaging	Het
Cfap44	A	T	16: 44,252,326 (GRCm39)	T812S	probably benign	Het
Cmklr1	G	C	5: 113,752,043 (GRCm39)	H319Q	probably benign	Het
Cp	A	T	3: 20,027,949 (GRCm39)	I452F	probably damaging	Het
Dcdc2c	T	A	12: 28,585,488 (GRCm39)	I2F	probably damaging	Het
Dlat	G	A	9: 50,570,906 (GRCm39)		probably benign	Het
Dock1	A	G	7: 134,601,017 (GRCm39)	D984G	possibly damaging	Het
Dsc2	T	C	18: 20,167,764 (GRCm39)	I710V	probably benign	Het
Eif4e	A	G	3: 138,252,122 (GRCm39)	E20G	probably benign	Het
Fbxw16	T	C	9: 109,265,679 (GRCm39)	Y380C	probably damaging	Het
Fscn3	A	G	6: 28,430,310 (GRCm39)	D160G	probably damaging	Het
Gm9195	G	A	14: 72,694,123 (GRCm39)	Q1531*	probably null	Het
Hps3	T	C	3: 20,084,575 (GRCm39)		probably null	Het
Idh2	TCCCAGG	T	7: 79,748,079 (GRCm39)		probably benign	Het
Igsf1	C	T	X: 48,875,736 (GRCm39)	E755K	probably null	Het
Kalrn	A	G	16: 34,181,371 (GRCm39)	V89A	probably damaging	Het
Kcng1	C	A	2: 168,104,535 (GRCm39)	G437V	probably damaging	Het
Krt82	C	T	15: 101,451,786 (GRCm39)	R343Q	probably benign	Het
Lbr	T	C	1: 181,645,068 (GRCm39)	D528G	possibly damaging	Het
Macf1	T	C	4: 123,406,819 (GRCm39)	E256G	probably damaging	Het
Mier2	T	C	10: 79,381,285 (GRCm39)		probably benign	Het
Mmp9	T	A	2: 164,792,726 (GRCm39)		probably null	Het
Myrf	A	G	19: 10,191,421 (GRCm39)		probably null	Het
Ncor1	T	A	11: 62,280,585 (GRCm39)	T82S	possibly damaging	Het
Or4c107	G	A	2: 88,789,055 (GRCm39)	V82I	probably benign	Het
P2rx6	G	T	16: 17,385,627 (GRCm39)	W176L	probably benign	Het
Pde4b	A	G	4: 102,454,657 (GRCm39)	E108G	probably damaging	Het
Pik3c2a	A	G	7: 115,993,531 (GRCm39)	V412A	probably damaging	Het
Prkd2	A	G	7: 16,584,131 (GRCm39)	E328G	probably benign	Het
Prmt1	A	C	7: 44,631,169 (GRCm39)	V114G	probably damaging	Het
Rnf133	G	A	6: 23,648,928 (GRCm39)	H334Y	probably benign	Het
Rps18-ps5	T	A	13: 28,441,626 (GRCm39)	L3Q	probably damaging	Het
Sel1l3	A	T	5: 53,279,213 (GRCm39)		probably benign	Het
Sf3a2	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	10: 80,640,271 (GRCm39)		probably benign	Het
Sfpq	CCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGC	4: 126,915,401 (GRCm39)		probably benign	Het
Slc35e1	G	A	8: 73,246,030 (GRCm39)	P134L		Het
Slc5a4b	A	T	10: 75,925,827 (GRCm39)		probably benign	Het
Slc9a3	A	G	13: 74,298,920 (GRCm39)	Y113C	probably damaging	Het
Ugt3a1	T	C	15: 9,306,333 (GRCm39)	F161L	possibly damaging	Het
Zhx2	T	C	15: 57,685,984 (GRCm39)	I451T	probably damaging	Het

Other mutations in Secisbp2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Secisbp2l	APN	2	125,585,776 (GRCm39)	missense	probably damaging	0.99
IGL00644:Secisbp2l	APN	2	125,585,764 (GRCm39)	missense	probably damaging	1.00
IGL01093:Secisbp2l	APN	2	125,582,245 (GRCm39)	missense	probably benign
IGL01621:Secisbp2l	APN	2	125,615,131 (GRCm39)	missense	probably benign
IGL01955:Secisbp2l	APN	2	125,585,732 (GRCm39)	critical splice donor site	probably null
IGL02036:Secisbp2l	APN	2	125,600,127 (GRCm39)	missense	probably benign
IGL02045:Secisbp2l	APN	2	125,617,498 (GRCm39)	missense	possibly damaging	0.82
IGL02182:Secisbp2l	APN	2	125,589,497 (GRCm39)	missense	probably damaging	1.00
IGL02408:Secisbp2l	APN	2	125,582,789 (GRCm39)	nonsense	probably null
IGL02455:Secisbp2l	APN	2	125,615,398 (GRCm39)	missense	possibly damaging	0.89
IGL02953:Secisbp2l	APN	2	125,602,194 (GRCm39)	missense	probably benign	0.36
Rift	UTSW	2	125,610,113 (GRCm39)	missense	probably damaging	1.00
Seismic	UTSW	2	125,587,829 (GRCm39)	missense	probably damaging	1.00
R0097:Secisbp2l	UTSW	2	125,613,376 (GRCm39)	missense	probably damaging	0.96
R0097:Secisbp2l	UTSW	2	125,613,376 (GRCm39)	missense	probably damaging	0.96
R1415:Secisbp2l	UTSW	2	125,582,285 (GRCm39)	missense	probably benign	0.00
R1626:Secisbp2l	UTSW	2	125,617,606 (GRCm39)	missense	probably damaging	0.99
R1926:Secisbp2l	UTSW	2	125,582,597 (GRCm39)	missense	probably damaging	0.99
R1940:Secisbp2l	UTSW	2	125,582,259 (GRCm39)	missense	probably damaging	1.00
R1970:Secisbp2l	UTSW	2	125,589,430 (GRCm39)	missense	probably damaging	1.00
R2100:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2240:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2252:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2253:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2472:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2474:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2475:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2990:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R2993:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3113:Secisbp2l	UTSW	2	125,592,206 (GRCm39)	missense	probably damaging	1.00
R3696:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3749:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3750:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3800:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3810:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3812:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3815:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3816:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3817:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R3880:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4077:Secisbp2l	UTSW	2	125,593,785 (GRCm39)	splice site	probably benign
R4096:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4097:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4164:Secisbp2l	UTSW	2	125,593,803 (GRCm39)	intron	probably benign
R4332:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4418:Secisbp2l	UTSW	2	125,594,835 (GRCm39)	missense	probably benign	0.00
R4598:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4600:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4602:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4603:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4678:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4679:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4684:Secisbp2l	UTSW	2	125,587,862 (GRCm39)	missense	probably damaging	1.00
R4741:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4749:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R4934:Secisbp2l	UTSW	2	125,582,409 (GRCm39)	missense	probably damaging	0.99
R5245:Secisbp2l	UTSW	2	125,589,511 (GRCm39)	missense	probably damaging	1.00
R5521:Secisbp2l	UTSW	2	125,594,897 (GRCm39)	missense	possibly damaging	0.94
R5547:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R5630:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R5631:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R5632:Secisbp2l	UTSW	2	125,582,657 (GRCm39)	missense	possibly damaging	0.66
R6039:Secisbp2l	UTSW	2	125,615,136 (GRCm39)	missense	probably benign	0.28
R6039:Secisbp2l	UTSW	2	125,615,136 (GRCm39)	missense	probably benign	0.28
R6378:Secisbp2l	UTSW	2	125,610,245 (GRCm39)	missense	possibly damaging	0.78
R6616:Secisbp2l	UTSW	2	125,610,146 (GRCm39)	missense	probably damaging	0.96
R6938:Secisbp2l	UTSW	2	125,592,272 (GRCm39)	missense	probably damaging	1.00
R7287:Secisbp2l	UTSW	2	125,582,289 (GRCm39)	missense	probably benign
R7373:Secisbp2l	UTSW	2	125,599,191 (GRCm39)	missense	probably damaging	0.99
R7403:Secisbp2l	UTSW	2	125,602,199 (GRCm39)	missense	possibly damaging	0.73
R7484:Secisbp2l	UTSW	2	125,613,452 (GRCm39)	nonsense	probably null
R7504:Secisbp2l	UTSW	2	125,600,091 (GRCm39)	missense	probably benign	0.30
R7762:Secisbp2l	UTSW	2	125,610,113 (GRCm39)	missense	probably damaging	1.00
R7769:Secisbp2l	UTSW	2	125,613,465 (GRCm39)	critical splice acceptor site	probably benign
R8018:Secisbp2l	UTSW	2	125,587,829 (GRCm39)	missense	probably damaging	1.00
R8487:Secisbp2l	UTSW	2	125,617,502 (GRCm39)	nonsense	probably null
R8784:Secisbp2l	UTSW	2	125,602,263 (GRCm39)	nonsense	probably null
R8810:Secisbp2l	UTSW	2	125,617,596 (GRCm39)	missense	possibly damaging	0.82
R8872:Secisbp2l	UTSW	2	125,594,892 (GRCm39)	missense	probably benign
R9154:Secisbp2l	UTSW	2	125,617,623 (GRCm39)	missense	probably damaging	1.00
R9155:Secisbp2l	UTSW	2	125,617,623 (GRCm39)	missense	probably damaging	1.00
R9589:Secisbp2l	UTSW	2	125,589,430 (GRCm39)	missense	probably damaging	1.00
R9589:Secisbp2l	UTSW	2	125,589,425 (GRCm39)	missense	probably benign	0.03
R9592:Secisbp2l	UTSW	2	125,582,561 (GRCm39)	missense	probably damaging	1.00
R9602:Secisbp2l	UTSW	2	125,609,356 (GRCm39)	missense	probably benign	0.19
R9620:Secisbp2l	UTSW	2	125,589,394 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTAACCTGTTAACACAATCACATA -3'
(R):5'- CTGTGTTTCAGTGCAGCAGG -3'

Sequencing Primer
(F):5'- ATGAGTACACTGTCACTGTTTCCAG -3'
(R):5'- CAGGTTGGATTCAGATGCA -3'

Posted On

2021-12-30