Mutagenetix > Incidental Mutations

Incidental Mutation 'R9111:Slc9a3'

692264

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9111 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74150801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 113 (Y113C)

Ref Sequence

ENSEMBL: ENSMUSP00000038142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: Y113C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: Y113C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: Y113C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225423
AA Change: Y113C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	T	C	8: 123,969,907	N210S		Het
Adamts17	A	G	7: 66,839,900	D22G	probably damaging	Het
Aldh3b1	T	C	19: 3,921,797	E58G	probably damaging	Het
Atg2a	G	A	19: 6,261,504	A1830T	probably damaging	Het
Birc6	T	C	17: 74,659,345	V4118A	probably damaging	Het
Ccdc28a	G	A	10: 18,225,002	P73S	possibly damaging	Het
Cdc42bpb	A	T	12: 111,318,469	D771E	probably benign	Het
Cdk14	G	A	5: 5,265,985	P13S	possibly damaging	Het
Cdr2	G	A	7: 120,960,122	S158F	possibly damaging	Het
Cfap44	A	T	16: 44,431,963	T812S	probably benign	Het
Cmklr1	G	C	5: 113,613,982	H319Q	probably benign	Het
Cp	A	T	3: 19,973,785	I452F	probably damaging	Het
Dcdc2c	T	A	12: 28,535,489	I2F	probably damaging	Het
Dock1	A	G	7: 134,999,288	D984G	possibly damaging	Het
Dsc2	T	C	18: 20,034,707	I710V	probably benign	Het
Eif4e	A	G	3: 138,546,361	E20G	probably benign	Het
Fbxw16	T	C	9: 109,436,611	Y380C	probably damaging	Het
Fscn3	A	G	6: 28,430,311	D160G	probably damaging	Het
Gm11361	T	A	13: 28,257,643	L3Q	probably damaging	Het
Gm9195	G	A	14: 72,456,683	Q1531*	probably null	Het
Hps3	T	C	3: 20,030,411		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Igsf1	C	T	X: 49,786,859	E755K	probably null	Het
Kalrn	A	G	16: 34,361,001	V89A	probably damaging	Het
Kcng1	C	A	2: 168,262,615	G437V	probably damaging	Het
Krt82	C	T	15: 101,543,351	R343Q	probably benign	Het
Lbr	T	C	1: 181,817,503	D528G	possibly damaging	Het
Macf1	T	C	4: 123,513,026	E256G	probably damaging	Het
Mmp9	T	A	2: 164,950,806		probably null	Het
Myrf	A	G	19: 10,214,057		probably null	Het
Ncor1	T	A	11: 62,389,759	T82S	possibly damaging	Het
Olfr1212	G	A	2: 88,958,711	V82I	probably benign	Het
P2rx6	G	T	16: 17,567,763	W176L	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pik3c2a	A	G	7: 116,394,296	V412A	probably damaging	Het
Prkd2	A	G	7: 16,850,206	E328G	probably benign	Het
Prmt1	A	C	7: 44,981,745	V114G	probably damaging	Het
Rnf133	G	A	6: 23,648,929	H334Y	probably benign	Het
Secisbp2l	A	G	2: 125,760,286	S385P	probably benign	Het
Sf3a2	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT	10: 80,804,437		probably benign	Het
Sfpq	CCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGC	4: 127,021,608		probably benign	Het
Slc35e1	G	A	8: 72,492,186	P134L		Het
Ugt3a1	T	C	15: 9,306,247	F161L	possibly damaging	Het
Zhx2	T	C	15: 57,822,588	I451T	probably damaging	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTATGAGCCCTGATCTGCC -3'
(R):5'- TACCTTGGGTAACAAAGTGACTTG -3'

Sequencing Primer
(F):5'- AGCCCTGATCTGCCTGACC -3'
(R):5'- GTGACTTGTATTCACCCAGAAGAC -3'

Posted On

2021-12-30