Incidental Mutation 'R9111:Slc9a3'
ID 692264
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9111 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74150801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 113 (Y113C)
Ref Sequence ENSEMBL: ENSMUSP00000038142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: Y113C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: Y113C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: Y113C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225423
AA Change: Y113C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,969,907 N210S Het
Adamts17 A G 7: 66,839,900 D22G probably damaging Het
Aldh3b1 T C 19: 3,921,797 E58G probably damaging Het
Atg2a G A 19: 6,261,504 A1830T probably damaging Het
Birc6 T C 17: 74,659,345 V4118A probably damaging Het
Ccdc28a G A 10: 18,225,002 P73S possibly damaging Het
Cdc42bpb A T 12: 111,318,469 D771E probably benign Het
Cdk14 G A 5: 5,265,985 P13S possibly damaging Het
Cdr2 G A 7: 120,960,122 S158F possibly damaging Het
Cfap44 A T 16: 44,431,963 T812S probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cp A T 3: 19,973,785 I452F probably damaging Het
Dcdc2c T A 12: 28,535,489 I2F probably damaging Het
Dock1 A G 7: 134,999,288 D984G possibly damaging Het
Dsc2 T C 18: 20,034,707 I710V probably benign Het
Eif4e A G 3: 138,546,361 E20G probably benign Het
Fbxw16 T C 9: 109,436,611 Y380C probably damaging Het
Fscn3 A G 6: 28,430,311 D160G probably damaging Het
Gm11361 T A 13: 28,257,643 L3Q probably damaging Het
Gm9195 G A 14: 72,456,683 Q1531* probably null Het
Hps3 T C 3: 20,030,411 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igsf1 C T X: 49,786,859 E755K probably null Het
Kalrn A G 16: 34,361,001 V89A probably damaging Het
Kcng1 C A 2: 168,262,615 G437V probably damaging Het
Krt82 C T 15: 101,543,351 R343Q probably benign Het
Lbr T C 1: 181,817,503 D528G possibly damaging Het
Macf1 T C 4: 123,513,026 E256G probably damaging Het
Mmp9 T A 2: 164,950,806 probably null Het
Myrf A G 19: 10,214,057 probably null Het
Ncor1 T A 11: 62,389,759 T82S possibly damaging Het
Olfr1212 G A 2: 88,958,711 V82I probably benign Het
P2rx6 G T 16: 17,567,763 W176L probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pik3c2a A G 7: 116,394,296 V412A probably damaging Het
Prkd2 A G 7: 16,850,206 E328G probably benign Het
Prmt1 A C 7: 44,981,745 V114G probably damaging Het
Rnf133 G A 6: 23,648,929 H334Y probably benign Het
Secisbp2l A G 2: 125,760,286 S385P probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sfpq CCAGCAGCAGCAGCAGC CCAGCAGCAGCAGC 4: 127,021,608 probably benign Het
Slc35e1 G A 8: 72,492,186 P134L Het
Ugt3a1 T C 15: 9,306,247 F161L possibly damaging Het
Zhx2 T C 15: 57,822,588 I451T probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTATGAGCCCTGATCTGCC -3'
(R):5'- TACCTTGGGTAACAAAGTGACTTG -3'

Sequencing Primer
(F):5'- AGCCCTGATCTGCCTGACC -3'
(R):5'- GTGACTTGTATTCACCCAGAAGAC -3'
Posted On 2021-12-30