Mutagenetix > Incidental Mutation

Incidental Mutation 'R9112:Golga3'

692293

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9112 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110185891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 131 (R131L)

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512] [ENSMUST00000139611]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031477
AA Change: R171L

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: R171L

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112512
AA Change: R131L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: R131L

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139611

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,209,980	S181G	possibly damaging	Het
5730596B20Rik	A	G	6: 52,179,433	R160G	unknown	Het
Acy1	A	G	9: 106,434,753	Y262H	probably benign	Het
Adamts13	T	C	2: 26,990,367	S681P	possibly damaging	Het
Adgra3	C	A	5: 49,961,053	C1051F	probably damaging	Het
Afp	T	C	5: 90,504,430		probably null	Het
Agrn	A	T	4: 156,177,057	V568E	probably damaging	Het
Ahnak	A	G	19: 9,009,785	E2811G	probably damaging	Het
Ap1m1	C	A	8: 72,240,222	Y7*	probably null	Het
Apobec1	T	A	6: 122,578,878	T207S	probably benign	Het
Arhgap32	G	A	9: 32,246,013	R102Q	probably damaging	Het
Bcat2	T	C	7: 45,588,022		probably null	Het
Cd209f	T	A	8: 4,105,802		probably benign	Het
Cox7c	G	A	13: 86,046,718		probably benign	Het
Cyp2d11	A	G	15: 82,392,002	V156A	possibly damaging	Het
Dhrs3	A	T	4: 144,927,199	T297S	probably benign	Het
Dip2c	T	C	13: 9,610,730	C876R	probably damaging	Het
Eprs	A	T	1: 185,397,076	I587F	probably damaging	Het
Fam13c	A	G	10: 70,451,148	T81A	probably benign	Het
Fam71d	T	C	12: 78,710,428		probably null	Het
Flt4	A	G	11: 49,633,237	Y548C	probably damaging	Het
Gimap4	T	A	6: 48,690,695	V128E	probably benign	Het
Gm10436	C	T	12: 88,177,285	A261T	possibly damaging	Het
Gm156	T	A	6: 129,766,734	I196F	probably benign	Het
Gm32742	A	G	9: 51,149,435	L856P	possibly damaging	Het
Gm5916	A	G	9: 36,120,962	Y59H	probably damaging	Het
Gnai3	A	T	3: 108,123,674	H57Q		Het
Gpc6	A	T	14: 117,186,676	I59F	probably benign	Het
Herc6	T	C	6: 57,619,619	S515P	probably damaging	Het
Hist1h2be	T	C	13: 23,585,770	M63V	possibly damaging	Het
Ift74	T	C	4: 94,686,866	I518T	probably benign	Het
Kat6b	T	C	14: 21,625,188	S474P	possibly damaging	Het
Kdelc2	A	G	9: 53,384,230	Y44C	probably damaging	Het
Klhl3	A	C	13: 58,100,398	I28S	unknown	Het
Lipi	A	G	16: 75,562,271	F259S	probably damaging	Het
Lrrc8a	T	A	2: 30,255,770	S199T	probably damaging	Het
Map2	T	A	1: 66,433,564	C1709*	probably null	Het
Mrgprf	A	G	7: 145,307,766	S22G	probably benign	Het
Myo1e	G	T	9: 70,367,701	R712L	probably benign	Het
Nras	A	T	3: 103,060,342	N85Y	probably benign	Het
Olfr1243	C	T	2: 89,527,993	C139Y	probably damaging	Het
Olfr1469	A	T	19: 13,411,111	I181F	probably benign	Het
Olfr1497	T	C	19: 13,795,416	H65R	probably damaging	Het
Olfr522	A	G	7: 140,162,747	S68P		Het
Pcp2	T	A	8: 3,624,638		probably benign	Het
Pigv	T	C	4: 133,664,768	R364G	probably benign	Het
Plekhh3	T	A	11: 101,170,799	S30C	probably damaging	Het
Pramef6	A	C	4: 143,896,764	V280G	possibly damaging	Het
Rhof	T	C	5: 123,120,508		probably benign	Het
Rufy3	A	T	5: 88,632,477	E361D		Het
Serpina1b	T	C	12: 103,732,440	D50G	probably benign	Het
Sgsm2	G	A	11: 74,865,396	Q376*	probably null	Het
Slc18b1	A	T	10: 23,816,364	I246F	probably damaging	Het
Slc38a9	A	T	13: 112,714,243	N387I	probably damaging	Het
Synrg	C	G	11: 83,971,583	P35A	probably damaging	Het
Tdrp	T	C	8: 13,955,796	K42E	probably damaging	Het
Trappc10	A	C	10: 78,193,367	M1112R	probably damaging	Het
Ube2e1	A	G	14: 18,285,203	V90A	probably damaging	Het
Vwde	C	A	6: 13,205,052	V277F	possibly damaging	Het
Zfyve16	A	G	13: 92,523,055	M116T	possibly damaging	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- TCATGGAATATAGGCGGCTGTG -3'
(R):5'- TGCAGCAGTTAAACATAGAAGC -3'

Sequencing Primer
(F):5'- GTGTTTTTCACAAGCTAACACATCTG -3'
(R):5'- CAGCAGTTAAACATAGAAGCAGTAAC -3'

Posted On

2021-12-30