Incidental Mutation 'R9112:Golga3'
ID 692293
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110185891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 131 (R131L)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512] [ENSMUST00000139611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: R171L

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: R171L

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: R131L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: R131L

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,209,980 S181G possibly damaging Het
5730596B20Rik A G 6: 52,179,433 R160G unknown Het
Acy1 A G 9: 106,434,753 Y262H probably benign Het
Adamts13 T C 2: 26,990,367 S681P possibly damaging Het
Adgra3 C A 5: 49,961,053 C1051F probably damaging Het
Afp T C 5: 90,504,430 probably null Het
Agrn A T 4: 156,177,057 V568E probably damaging Het
Ahnak A G 19: 9,009,785 E2811G probably damaging Het
Ap1m1 C A 8: 72,240,222 Y7* probably null Het
Apobec1 T A 6: 122,578,878 T207S probably benign Het
Arhgap32 G A 9: 32,246,013 R102Q probably damaging Het
Bcat2 T C 7: 45,588,022 probably null Het
Cd209f T A 8: 4,105,802 probably benign Het
Cox7c G A 13: 86,046,718 probably benign Het
Cyp2d11 A G 15: 82,392,002 V156A possibly damaging Het
Dhrs3 A T 4: 144,927,199 T297S probably benign Het
Dip2c T C 13: 9,610,730 C876R probably damaging Het
Eprs A T 1: 185,397,076 I587F probably damaging Het
Fam13c A G 10: 70,451,148 T81A probably benign Het
Fam71d T C 12: 78,710,428 probably null Het
Flt4 A G 11: 49,633,237 Y548C probably damaging Het
Gimap4 T A 6: 48,690,695 V128E probably benign Het
Gm10436 C T 12: 88,177,285 A261T possibly damaging Het
Gm156 T A 6: 129,766,734 I196F probably benign Het
Gm32742 A G 9: 51,149,435 L856P possibly damaging Het
Gm5916 A G 9: 36,120,962 Y59H probably damaging Het
Gnai3 A T 3: 108,123,674 H57Q Het
Gpc6 A T 14: 117,186,676 I59F probably benign Het
Herc6 T C 6: 57,619,619 S515P probably damaging Het
Hist1h2be T C 13: 23,585,770 M63V possibly damaging Het
Ift74 T C 4: 94,686,866 I518T probably benign Het
Kat6b T C 14: 21,625,188 S474P possibly damaging Het
Kdelc2 A G 9: 53,384,230 Y44C probably damaging Het
Klhl3 A C 13: 58,100,398 I28S unknown Het
Lipi A G 16: 75,562,271 F259S probably damaging Het
Lrrc8a T A 2: 30,255,770 S199T probably damaging Het
Map2 T A 1: 66,433,564 C1709* probably null Het
Mrgprf A G 7: 145,307,766 S22G probably benign Het
Myo1e G T 9: 70,367,701 R712L probably benign Het
Nras A T 3: 103,060,342 N85Y probably benign Het
Olfr1243 C T 2: 89,527,993 C139Y probably damaging Het
Olfr1469 A T 19: 13,411,111 I181F probably benign Het
Olfr1497 T C 19: 13,795,416 H65R probably damaging Het
Olfr522 A G 7: 140,162,747 S68P Het
Pigv T C 4: 133,664,768 R364G probably benign Het
Plekhh3 T A 11: 101,170,799 S30C probably damaging Het
Pramef6 A C 4: 143,896,764 V280G possibly damaging Het
Rufy3 A T 5: 88,632,477 E361D Het
Serpina1b T C 12: 103,732,440 D50G probably benign Het
Sgsm2 G A 11: 74,865,396 Q376* probably null Het
Slc18b1 A T 10: 23,816,364 I246F probably damaging Het
Slc38a9 A T 13: 112,714,243 N387I probably damaging Het
Synrg C G 11: 83,971,583 P35A probably damaging Het
Tdrp T C 8: 13,955,796 K42E probably damaging Het
Trappc10 A C 10: 78,193,367 M1112R probably damaging Het
Ube2e1 A G 14: 18,285,203 V90A probably damaging Het
Vwde C A 6: 13,205,052 V277F possibly damaging Het
Zfyve16 A G 13: 92,523,055 M116T possibly damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCATGGAATATAGGCGGCTGTG -3'
(R):5'- TGCAGCAGTTAAACATAGAAGC -3'

Sequencing Primer
(F):5'- GTGTTTTTCACAAGCTAACACATCTG -3'
(R):5'- CAGCAGTTAAACATAGAAGCAGTAAC -3'
Posted On 2021-12-30