Incidental Mutation 'R9112:Sgsm2'
ID 692317
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Name small G protein signaling modulator 2
Synonyms D630003G22Rik, Rutbc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R9112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74849261-74897060 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 74865396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 376 (Q376*)
Ref Sequence ENSEMBL: ENSMUSP00000050496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
AlphaFold Q80U12
Predicted Effect probably null
Transcript: ENSMUST00000057631
AA Change: Q376*
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: Q376*

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081799
AA Change: Q376*
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: Q376*

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,209,980 S181G possibly damaging Het
5730596B20Rik A G 6: 52,179,433 R160G unknown Het
Acy1 A G 9: 106,434,753 Y262H probably benign Het
Adamts13 T C 2: 26,990,367 S681P possibly damaging Het
Adgra3 C A 5: 49,961,053 C1051F probably damaging Het
Afp T C 5: 90,504,430 probably null Het
Agrn A T 4: 156,177,057 V568E probably damaging Het
Ahnak A G 19: 9,009,785 E2811G probably damaging Het
Ap1m1 C A 8: 72,240,222 Y7* probably null Het
Apobec1 T A 6: 122,578,878 T207S probably benign Het
Arhgap32 G A 9: 32,246,013 R102Q probably damaging Het
Bcat2 T C 7: 45,588,022 probably null Het
Cd209f T A 8: 4,105,802 probably benign Het
Cox7c G A 13: 86,046,718 probably benign Het
Cyp2d11 A G 15: 82,392,002 V156A possibly damaging Het
Dhrs3 A T 4: 144,927,199 T297S probably benign Het
Dip2c T C 13: 9,610,730 C876R probably damaging Het
Eprs A T 1: 185,397,076 I587F probably damaging Het
Fam13c A G 10: 70,451,148 T81A probably benign Het
Fam71d T C 12: 78,710,428 probably null Het
Flt4 A G 11: 49,633,237 Y548C probably damaging Het
Gimap4 T A 6: 48,690,695 V128E probably benign Het
Gm10436 C T 12: 88,177,285 A261T possibly damaging Het
Gm156 T A 6: 129,766,734 I196F probably benign Het
Gm32742 A G 9: 51,149,435 L856P possibly damaging Het
Gm5916 A G 9: 36,120,962 Y59H probably damaging Het
Gnai3 A T 3: 108,123,674 H57Q Het
Golga3 G T 5: 110,185,891 R131L probably benign Het
Gpc6 A T 14: 117,186,676 I59F probably benign Het
Herc6 T C 6: 57,619,619 S515P probably damaging Het
Hist1h2be T C 13: 23,585,770 M63V possibly damaging Het
Ift74 T C 4: 94,686,866 I518T probably benign Het
Kat6b T C 14: 21,625,188 S474P possibly damaging Het
Kdelc2 A G 9: 53,384,230 Y44C probably damaging Het
Klhl3 A C 13: 58,100,398 I28S unknown Het
Lipi A G 16: 75,562,271 F259S probably damaging Het
Lrrc8a T A 2: 30,255,770 S199T probably damaging Het
Map2 T A 1: 66,433,564 C1709* probably null Het
Mrgprf A G 7: 145,307,766 S22G probably benign Het
Myo1e G T 9: 70,367,701 R712L probably benign Het
Nras A T 3: 103,060,342 N85Y probably benign Het
Olfr1243 C T 2: 89,527,993 C139Y probably damaging Het
Olfr1469 A T 19: 13,411,111 I181F probably benign Het
Olfr1497 T C 19: 13,795,416 H65R probably damaging Het
Olfr522 A G 7: 140,162,747 S68P Het
Pigv T C 4: 133,664,768 R364G probably benign Het
Plekhh3 T A 11: 101,170,799 S30C probably damaging Het
Pramef6 A C 4: 143,896,764 V280G possibly damaging Het
Rufy3 A T 5: 88,632,477 E361D Het
Serpina1b T C 12: 103,732,440 D50G probably benign Het
Slc18b1 A T 10: 23,816,364 I246F probably damaging Het
Slc38a9 A T 13: 112,714,243 N387I probably damaging Het
Synrg C G 11: 83,971,583 P35A probably damaging Het
Tdrp T C 8: 13,955,796 K42E probably damaging Het
Trappc10 A C 10: 78,193,367 M1112R probably damaging Het
Ube2e1 A G 14: 18,285,203 V90A probably damaging Het
Vwde C A 6: 13,205,052 V277F possibly damaging Het
Zfyve16 A G 13: 92,523,055 M116T possibly damaging Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
R9184:Sgsm2 UTSW 11 74892008 missense possibly damaging 0.63
R9226:Sgsm2 UTSW 11 74858134 missense possibly damaging 0.72
R9391:Sgsm2 UTSW 11 74853804 missense probably damaging 1.00
R9458:Sgsm2 UTSW 11 74868731 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AATGGTCAGGCTGTCCAGTG -3'
(R):5'- TTCCTAGCCTGGGAAATCTCAC -3'

Sequencing Primer
(F):5'- GTGTGCAGTCCCACCCAAAG -3'
(R):5'- AGCCTGGGAAATCTCACCTGTTG -3'
Posted On 2021-12-30