Incidental Mutation 'R9113:Agbl1'
ID 692357
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene Name ATP/GTP binding protein-like 1
Synonyms Nna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9113 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 76229887-77124698 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 76589477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 827 (A827E)
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026854
AA Change: A575E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: A575E

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107442
AA Change: A575E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: A575E

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: A827E
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: A827E

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,295,518 Q553* probably null Het
Abcc9 T A 6: 142,645,930 I791F probably damaging Het
Adamts15 A G 9: 30,911,202 M389T probably damaging Het
Adgrb2 G A 4: 130,017,084 V1065M probably damaging Het
Alox5ap T C 5: 149,279,205 F67S probably damaging Het
Ankrd11 T C 8: 122,887,333 N2566S possibly damaging Het
Arhgap10 T C 8: 77,259,072 D722G probably damaging Het
Atp5j2 A G 5: 145,191,505 L4P probably benign Het
Bean1 T C 8: 104,213,925 V130A probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdhr2 A G 13: 54,734,887 D1222G probably benign Het
Chrm4 T A 2: 91,927,730 V161E probably benign Het
Ckap5 T C 2: 91,595,799 S1335P probably damaging Het
Col11a1 T A 3: 114,094,543 Y267* probably null Het
Col14a1 T C 15: 55,338,429 Y38H unknown Het
Coro2a C T 4: 46,563,047 G36S Het
Ctsc A T 7: 88,309,896 K461N possibly damaging Het
Dcaf1 A G 9: 106,835,632 probably benign Het
Dnah9 A G 11: 65,989,887 I2628T probably damaging Het
Dnajb5 T C 4: 42,953,233 I20T probably damaging Het
Dus2 C T 8: 106,048,701 Q287* probably null Het
Fbxl17 A G 17: 63,225,090 V586A probably benign Het
Glg1 A T 8: 111,160,820 probably benign Het
Gm10639 A T 9: 78,305,385 I213F probably benign Het
Gm4924 G A 10: 82,378,279 C637Y unknown Het
Gorasp1 A G 9: 119,928,376 F310S probably damaging Het
Igfn1 G A 1: 135,955,590 T2726I probably damaging Het
Inppl1 G T 7: 101,826,024 P940Q probably benign Het
Klk1b22 G A 7: 44,116,268 V183M possibly damaging Het
Krt12 A G 11: 99,418,552 M294T probably damaging Het
Krtap6-2 GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA 16: 89,419,725 probably benign Het
Lep T C 6: 29,071,094 L139P probably damaging Het
Ltn1 T C 16: 87,427,644 D64G probably damaging Het
Lyzl1 C T 18: 4,168,604 A28V probably null Het
Mcam T C 9: 44,140,396 V483A probably benign Het
Mia2 C T 12: 59,170,267 probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Pde10a A G 17: 8,978,950 T742A probably benign Het
Rapgef4 A G 2: 72,031,149 Y61C probably benign Het
Ryr2 A T 13: 11,603,855 probably benign Het
Setbp1 G T 18: 78,857,733 H906Q probably damaging Het
Slc12a4 A G 8: 105,944,352 V1032A probably benign Het
Slc6a15 T C 10: 103,400,279 M285T probably damaging Het
Steap2 A G 5: 5,677,475 Y287H probably damaging Het
Tas2r135 T G 6: 42,406,381 F285V probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Ttn T C 2: 76,788,194 T16249A probably benign Het
Usp8 A G 2: 126,737,423 T299A probably benign Het
Vmn2r101 A G 17: 19,591,026 I457M possibly damaging Het
Vps41 A G 13: 18,839,713 E437G probably benign Het
Zfp638 A T 6: 83,976,912 E1333V probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
R8406:Agbl1 UTSW 7 76418667 missense
R8432:Agbl1 UTSW 7 77124686 missense unknown
R8704:Agbl1 UTSW 7 76589554 splice site probably benign
R8830:Agbl1 UTSW 7 76335311 missense
R8985:Agbl1 UTSW 7 76320156 missense
R9170:Agbl1 UTSW 7 76335321 missense
R9229:Agbl1 UTSW 7 77124522 missense unknown
R9255:Agbl1 UTSW 7 76766402 missense unknown
R9391:Agbl1 UTSW 7 76421854 missense unknown
R9646:Agbl1 UTSW 7 76425900 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGCCCCAGAGACTGTTGATG -3'
(R):5'- TTGGTTCAGATAGATGGAGCC -3'

Sequencing Primer
(F):5'- CCCCAGAGACTGTTGATGGAAATG -3'
(R):5'- GAGATCCCTATAGAGTATCAAGGCC -3'
Posted On 2021-12-30