Incidental Mutation 'R9114:Dclk3'
ID 692426
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Name doublecortin-like kinase 3
Synonyms Click-I, -II related, Dcamkl3
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R9114 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111439081-111489118 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111488615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 773 (M773K)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
AlphaFold Q8BWQ5
Predicted Effect probably benign
Transcript: ENSMUST00000111879
AA Change: M773K

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: M773K

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,738,702 L1027* probably null Het
Actl11 T A 9: 107,931,310 M944K possibly damaging Het
Afap1l2 T C 19: 56,917,995 K491E probably damaging Het
Ahr A T 12: 35,511,165 D150E probably damaging Het
Arhgef1 T A 7: 24,907,879 L17Q probably damaging Het
Bysl A G 17: 47,604,317 S169P Het
C4b A T 17: 34,729,430 F1610I probably damaging Het
Chtf8 C A 8: 106,885,849 A153S probably benign Het
Ciapin1 C T 8: 94,831,772 probably null Het
Cnnm1 A G 19: 43,440,956 E171G possibly damaging Het
Crybb3 T C 5: 113,077,541 N155S probably benign Het
Ddx18 A T 1: 121,561,538 V260D probably damaging Het
Dmxl2 T A 9: 54,400,037 N2216Y Het
Epn2 T C 11: 61,546,620 E42G probably damaging Het
Esrrg C A 1: 188,146,408 P229T probably benign Het
Esrrg C A 1: 188,146,409 P229Q possibly damaging Het
Ethe1 G T 7: 24,606,218 R130L probably benign Het
Fgl2 G A 5: 21,375,365 C235Y probably damaging Het
Fmnl1 C T 11: 103,196,501 T890M unknown Het
Fsip2 C G 2: 82,976,957 P1207A probably benign Het
Gc C T 5: 89,445,306 D85N possibly damaging Het
Gfi1 G A 5: 107,721,504 R287W probably damaging Het
Gm3460 T C 14: 6,619,567 probably null Het
Hapln3 A G 7: 79,121,964 F59S probably benign Het
Il24 G A 1: 130,885,746 T38I possibly damaging Het
Izumo1 A G 7: 45,627,159 D382G probably benign Het
Kdm5a T A 6: 120,405,926 Y739* probably null Het
Kif2b T A 11: 91,575,712 I582F possibly damaging Het
Klhdc1 A G 12: 69,242,009 Y31C probably damaging Het
Lama1 G A 17: 67,821,674 E3009K Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Mark1 A C 1: 184,912,064 S468A probably damaging Het
Mknk2 T A 10: 80,668,989 N236Y probably damaging Het
Muc2 T A 7: 141,701,414 C251* probably null Het
Nacad T C 11: 6,602,252 D313G probably damaging Het
Neb G T 2: 52,209,587 D4750E probably benign Het
Nlrp6 T C 7: 140,926,419 S758P probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr61 A C 7: 140,638,369 I223L probably benign Het
Olfr66 T C 7: 103,881,362 T294A possibly damaging Het
Olfr918 A G 9: 38,672,596 F283L probably benign Het
Oxtr A G 6: 112,489,520 V93A probably damaging Het
Pbx3 C A 2: 34,213,259 D234Y probably damaging Het
Pde4b A T 4: 102,602,629 T554S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pid1 A T 1: 84,038,234 Y151N probably damaging Het
Plcd4 A G 1: 74,552,148 E234G possibly damaging Het
Pou6f1 A G 15: 100,580,908 V373A probably benign Het
Ppp1r12c T C 7: 4,482,793 K685E possibly damaging Het
Rnf34 T A 5: 122,861,894 V71D probably damaging Het
Rpap2 T G 5: 107,598,290 H11Q possibly damaging Het
Skint2 A G 4: 112,639,637 T247A probably benign Het
Stat5b T A 11: 100,801,524 N145Y probably damaging Het
Sv2b A G 7: 75,206,269 L91P probably damaging Het
Syt1 A G 10: 108,504,515 I314T probably damaging Het
Tlk1 A T 2: 70,742,158 N355K probably benign Het
Tnc C A 4: 63,972,736 M1636I probably benign Het
Trank1 C A 9: 111,333,775 A34D probably damaging Het
Unc13c A G 9: 73,812,383 I1001T probably benign Het
Vdr T C 15: 97,867,255 D201G probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr81 C A 11: 75,444,424 R1772L probably damaging Het
Zfp457 T C 13: 67,294,004 D169G probably benign Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
G1citation:Dclk3 UTSW 9 111439337 missense probably benign 0.03
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111482721 missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111469070 missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4111:Dclk3 UTSW 9 111469080 missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5338:Dclk3 UTSW 9 111469059 missense possibly damaging 0.95
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
R6995:Dclk3 UTSW 9 111467700 missense possibly damaging 0.88
R7187:Dclk3 UTSW 9 111484996 missense probably damaging 1.00
R7532:Dclk3 UTSW 9 111467528 missense probably benign 0.03
R7534:Dclk3 UTSW 9 111468218 missense probably benign
R7734:Dclk3 UTSW 9 111469095 missense probably damaging 1.00
R8326:Dclk3 UTSW 9 111467534 missense probably damaging 0.96
R8372:Dclk3 UTSW 9 111485013 missense probably damaging 0.98
R8388:Dclk3 UTSW 9 111482745 missense probably damaging 1.00
R8423:Dclk3 UTSW 9 111468719 missense possibly damaging 0.93
R8493:Dclk3 UTSW 9 111468147 missense probably benign 0.06
R9013:Dclk3 UTSW 9 111468498 missense probably benign 0.31
R9338:Dclk3 UTSW 9 111439305 missense unknown
R9412:Dclk3 UTSW 9 111482751 critical splice donor site probably null
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACAGTGCTAATGTGGATG -3'
(R):5'- TGTGGAGAAGGGTCTTGCAC -3'

Sequencing Primer
(F):5'- ATGTGTGGGCTCCTACCTCATG -3'
(R):5'- ACAGCCTTGCTTGTAGACTAGACG -3'
Posted On 2021-12-30