Incidental Mutation 'R9114:Syt1'
ID 692428
Institutional Source Beutler Lab
Gene Symbol Syt1
Ensembl Gene ENSMUSG00000035864
Gene Name synaptotagmin I
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9114 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 108497650-109010982 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108504515 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 314 (I314T)
Ref Sequence ENSEMBL: ENSMUSP00000063293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064054] [ENSMUST00000105276]
AlphaFold P46096
Predicted Effect probably damaging
Transcript: ENSMUST00000064054
AA Change: I314T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063293
Gene: ENSMUSG00000035864
AA Change: I314T

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.8e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105276
AA Change: I314T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100912
Gene: ENSMUSG00000035864
AA Change: I314T

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.9e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous null mice do not suckle, show impaired synaptic transmission and Ca2+-evoked neurotransmitter release, and die by 48 hrs of life. Knock-in mice bearing a missense mutation show enhanced synaptic depression while those carrying a point mutationshow reduced synaptic release probability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,738,702 L1027* probably null Het
Actl11 T A 9: 107,931,310 M944K possibly damaging Het
Afap1l2 T C 19: 56,917,995 K491E probably damaging Het
Ahr A T 12: 35,511,165 D150E probably damaging Het
Arhgef1 T A 7: 24,907,879 L17Q probably damaging Het
Bysl A G 17: 47,604,317 S169P Het
C4b A T 17: 34,729,430 F1610I probably damaging Het
Chtf8 C A 8: 106,885,849 A153S probably benign Het
Ciapin1 C T 8: 94,831,772 probably null Het
Cnnm1 A G 19: 43,440,956 E171G possibly damaging Het
Crybb3 T C 5: 113,077,541 N155S probably benign Het
Dclk3 T A 9: 111,488,615 M773K probably benign Het
Ddx18 A T 1: 121,561,538 V260D probably damaging Het
Dmxl2 T A 9: 54,400,037 N2216Y Het
Epn2 T C 11: 61,546,620 E42G probably damaging Het
Esrrg C A 1: 188,146,408 P229T probably benign Het
Esrrg C A 1: 188,146,409 P229Q possibly damaging Het
Ethe1 G T 7: 24,606,218 R130L probably benign Het
Fgl2 G A 5: 21,375,365 C235Y probably damaging Het
Fmnl1 C T 11: 103,196,501 T890M unknown Het
Fsip2 C G 2: 82,976,957 P1207A probably benign Het
Gc C T 5: 89,445,306 D85N possibly damaging Het
Gfi1 G A 5: 107,721,504 R287W probably damaging Het
Gm3460 T C 14: 6,619,567 probably null Het
Hapln3 A G 7: 79,121,964 F59S probably benign Het
Il24 G A 1: 130,885,746 T38I possibly damaging Het
Izumo1 A G 7: 45,627,159 D382G probably benign Het
Kdm5a T A 6: 120,405,926 Y739* probably null Het
Kif2b T A 11: 91,575,712 I582F possibly damaging Het
Klhdc1 A G 12: 69,242,009 Y31C probably damaging Het
Lama1 G A 17: 67,821,674 E3009K Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Mark1 A C 1: 184,912,064 S468A probably damaging Het
Mknk2 T A 10: 80,668,989 N236Y probably damaging Het
Muc2 T A 7: 141,701,414 C251* probably null Het
Nacad T C 11: 6,602,252 D313G probably damaging Het
Neb G T 2: 52,209,587 D4750E probably benign Het
Nlrp6 T C 7: 140,926,419 S758P probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr61 A C 7: 140,638,369 I223L probably benign Het
Olfr66 T C 7: 103,881,362 T294A possibly damaging Het
Olfr918 A G 9: 38,672,596 F283L probably benign Het
Oxtr A G 6: 112,489,520 V93A probably damaging Het
Pbx3 C A 2: 34,213,259 D234Y probably damaging Het
Pde4b A T 4: 102,602,629 T554S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pid1 A T 1: 84,038,234 Y151N probably damaging Het
Plcd4 A G 1: 74,552,148 E234G possibly damaging Het
Pou6f1 A G 15: 100,580,908 V373A probably benign Het
Ppp1r12c T C 7: 4,482,793 K685E possibly damaging Het
Rnf34 T A 5: 122,861,894 V71D probably damaging Het
Rpap2 T G 5: 107,598,290 H11Q possibly damaging Het
Skint2 A G 4: 112,639,637 T247A probably benign Het
Stat5b T A 11: 100,801,524 N145Y probably damaging Het
Sv2b A G 7: 75,206,269 L91P probably damaging Het
Tlk1 A T 2: 70,742,158 N355K probably benign Het
Tnc C A 4: 63,972,736 M1636I probably benign Het
Trank1 C A 9: 111,333,775 A34D probably damaging Het
Unc13c A G 9: 73,812,383 I1001T probably benign Het
Vdr T C 15: 97,867,255 D201G probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr81 C A 11: 75,444,424 R1772L probably damaging Het
Zfp457 T C 13: 67,294,004 D169G probably benign Het
Other mutations in Syt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Syt1 APN 10 108583975 missense possibly damaging 0.49
R1067:Syt1 UTSW 10 108636662 missense probably benign
R1300:Syt1 UTSW 10 108631821 missense possibly damaging 0.95
R1370:Syt1 UTSW 10 108690922 missense probably damaging 0.98
R1575:Syt1 UTSW 10 108504500 missense probably benign 0.04
R1656:Syt1 UTSW 10 108583915 missense probably damaging 1.00
R2072:Syt1 UTSW 10 108583972 missense probably damaging 1.00
R2212:Syt1 UTSW 10 108504414 missense possibly damaging 0.89
R2429:Syt1 UTSW 10 108690920 missense possibly damaging 0.86
R4928:Syt1 UTSW 10 108504512 missense possibly damaging 0.95
R5216:Syt1 UTSW 10 108642257 missense probably benign 0.00
R6161:Syt1 UTSW 10 108631807 missense probably damaging 1.00
R6193:Syt1 UTSW 10 108500736 missense probably benign 0.38
R7033:Syt1 UTSW 10 108690936 missense probably benign
R7535:Syt1 UTSW 10 108627422 critical splice acceptor site probably null
R7574:Syt1 UTSW 10 108504401 missense probably damaging 1.00
R7913:Syt1 UTSW 10 108642248 missense probably benign 0.00
R8003:Syt1 UTSW 10 108636573 missense probably damaging 1.00
R8829:Syt1 UTSW 10 108642332 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TATGCGATCTGAAGGCGTGAG -3'
(R):5'- ATGATCTAAAACATGGCTCTGGAG -3'

Sequencing Primer
(F):5'- GCGTGAGACTGAGTGGGG -3'
(R):5'- TAATGACCTGAGTCTGATCCCGAG -3'
Posted On 2021-12-30