Mutagenetix > Incidental Mutations

Ensembl: ENSMUST00000019400

Incidental Mutation 'R9114:Ahr'

692435

Institutional Source

Beutler Lab

Gene Symbol

Ahr

Ensembl Gene

ENSMUSG00000019256

Gene Name

aryl-hydrocarbon receptor

Synonyms

bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre

Accession Numbers

Genbank: NM_013464; MGI: 105043;

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R9114 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35497974-35535038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35511165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 150 (D150E)

Ref Sequence

ENSEMBL: ENSMUSP00000112137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110811

SMART Domains

Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

Domain	Start	End	E-Value	Type
HLH	33	87	3.31e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000116436
AA Change: D150E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: D150E

Domain	Start	End	E-Value	Type
HLH	33	87	5.09e-7	SMART
PAS	111	177	2.72e-12	SMART
low complexity region	212	222	N/A	INTRINSIC
PAS	266	336	1.77e-2	SMART
PAC	342	383	2.39e-8	SMART
low complexity region	606	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,738,702	L1027*	probably null	Het
Actl11	T	A	9: 107,931,310	M944K	possibly damaging	Het
Afap1l2	T	C	19: 56,917,995	K491E	probably damaging	Het
Arhgef1	T	A	7: 24,907,879	L17Q	probably damaging	Het
Bysl	A	G	17: 47,604,317	S169P		Het
C4b	A	T	17: 34,729,430	F1610I	probably damaging	Het
Chtf8	C	A	8: 106,885,849	A153S	probably benign	Het
Ciapin1	C	T	8: 94,831,772		probably null	Het
Cnnm1	A	G	19: 43,440,956	E171G	possibly damaging	Het
Crybb3	T	C	5: 113,077,541	N155S	probably benign	Het
Dclk3	T	A	9: 111,488,615	M773K	probably benign	Het
Ddx18	A	T	1: 121,561,538	V260D	probably damaging	Het
Dmxl2	T	A	9: 54,400,037	N2216Y		Het
Epn2	T	C	11: 61,546,620	E42G	probably damaging	Het
Esrrg	C	A	1: 188,146,408	P229T	probably benign	Het
Esrrg	C	A	1: 188,146,409	P229Q	possibly damaging	Het
Ethe1	G	T	7: 24,606,218	R130L	probably benign	Het
Fgl2	G	A	5: 21,375,365	C235Y	probably damaging	Het
Fmnl1	C	T	11: 103,196,501	T890M	unknown	Het
Fsip2	C	G	2: 82,976,957	P1207A	probably benign	Het
Gc	C	T	5: 89,445,306	D85N	possibly damaging	Het
Gfi1	G	A	5: 107,721,504	R287W	probably damaging	Het
Gm3460	T	C	14: 6,619,567		probably null	Het
Hapln3	A	G	7: 79,121,964	F59S	probably benign	Het
Il24	G	A	1: 130,885,746	T38I	possibly damaging	Het
Izumo1	A	G	7: 45,627,159	D382G	probably benign	Het
Kdm5a	T	A	6: 120,405,926	Y739*	probably null	Het
Kif2b	T	A	11: 91,575,712	I582F	possibly damaging	Het
Klhdc1	A	G	12: 69,242,009	Y31C	probably damaging	Het
Lama1	G	A	17: 67,821,674	E3009K		Het
Mad2l1bp	G	A	17: 46,148,032	R191C	probably damaging	Het
Mark1	A	C	1: 184,912,064	S468A	probably damaging	Het
Mknk2	T	A	10: 80,668,989	N236Y	probably damaging	Het
Muc2	T	A	7: 141,701,414	C251*	probably null	Het
Nacad	T	C	11: 6,602,252	D313G	probably damaging	Het
Neb	G	T	2: 52,209,587	D4750E	probably benign	Het
Nlrp6	T	C	7: 140,926,419	S758P	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr61	A	C	7: 140,638,369	I223L	probably benign	Het
Olfr66	T	C	7: 103,881,362	T294A	possibly damaging	Het
Olfr918	A	G	9: 38,672,596	F283L	probably benign	Het
Oxtr	A	G	6: 112,489,520	V93A	probably damaging	Het
Pbx3	C	A	2: 34,213,259	D234Y	probably damaging	Het
Pde4b	A	T	4: 102,602,629	T554S	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pid1	A	T	1: 84,038,234	Y151N	probably damaging	Het
Plcd4	A	G	1: 74,552,148	E234G	possibly damaging	Het
Pou6f1	A	G	15: 100,580,908	V373A	probably benign	Het
Ppp1r12c	T	C	7: 4,482,793	K685E	possibly damaging	Het
Rnf34	T	A	5: 122,861,894	V71D	probably damaging	Het
Rpap2	T	G	5: 107,598,290	H11Q	possibly damaging	Het
Skint2	A	G	4: 112,639,637	T247A	probably benign	Het
Stat5b	T	A	11: 100,801,524	N145Y	probably damaging	Het
Sv2b	A	G	7: 75,206,269	L91P	probably damaging	Het
Syt1	A	G	10: 108,504,515	I314T	probably damaging	Het
Tlk1	A	T	2: 70,742,158	N355K	probably benign	Het
Tnc	C	A	4: 63,972,736	M1636I	probably benign	Het
Trank1	C	A	9: 111,333,775	A34D	probably damaging	Het
Unc13c	A	G	9: 73,812,383	I1001T	probably benign	Het
Vdr	T	C	15: 97,867,255	D201G	probably benign	Het
Vmn2r115	A	T	17: 23,345,333	I160L	probably benign	Het
Wdr81	C	A	11: 75,444,424	R1772L	probably damaging	Het
Zfp457	T	C	13: 67,294,004	D169G	probably benign	Het

Other mutations in Ahr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Ahr	APN	12	35504097	nonsense	probably null
IGL01336:Ahr	APN	12	35503840	missense	probably benign	0.19
IGL01972:Ahr	APN	12	35504449	missense	possibly damaging	0.89
IGL02117:Ahr	APN	12	35512923	nonsense	probably null
IGL03028:Ahr	APN	12	35504710	missense	probably benign
IGL03110:Ahr	APN	12	35504971	missense	probably damaging	0.98
IGL03394:Ahr	APN	12	35503752	nonsense	probably null
IGL03403:Ahr	APN	12	35504326	missense	possibly damaging	0.63
BB002:Ahr	UTSW	12	35515068	nonsense	probably null
BB012:Ahr	UTSW	12	35515068	nonsense	probably null
R0620:Ahr	UTSW	12	35508194	missense	probably benign	0.26
R0784:Ahr	UTSW	12	35508142	missense	possibly damaging	0.79
R1133:Ahr	UTSW	12	35526806	missense	probably damaging	1.00
R1168:Ahr	UTSW	12	35504532	missense	possibly damaging	0.49
R4678:Ahr	UTSW	12	35507464	missense	probably damaging	1.00
R5615:Ahr	UTSW	12	35503885	missense	probably benign	0.01
R6066:Ahr	UTSW	12	35504921	missense	probably damaging	0.99
R6466:Ahr	UTSW	12	35504032	missense	probably benign	0.29
R7369:Ahr	UTSW	12	35504660	missense	possibly damaging	0.94
R7382:Ahr	UTSW	12	35504515	missense	probably damaging	1.00
R7685:Ahr	UTSW	12	35504017	missense	probably damaging	0.96
R7819:Ahr	UTSW	12	35510000	missense	probably damaging	1.00
R7897:Ahr	UTSW	12	35504170	missense	possibly damaging	0.47
R7925:Ahr	UTSW	12	35515068	nonsense	probably null
R8179:Ahr	UTSW	12	35510051	missense	probably benign	0.01
R8274:Ahr	UTSW	12	35510069	missense	probably benign
R8342:Ahr	UTSW	12	35508272	missense	probably damaging	1.00
R8985:Ahr	UTSW	12	35526737	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CCCTATCTTCAGCATGGAGC -3'
(R):5'- AACAGGAAGCTGCCTTGTG -3'

Sequencing Primer
(F):5'- GGAGCTCTATGCCTTTCTTTCATAG -3'
(R):5'- AAGCTGCCTTGTGAGCCAGAG -3'

Posted On

2021-12-30