Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R9114:Ahr'
ID 692435
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
Accession Numbers

Genbank: NM_013464; MGI: 105043

  
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R9114 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35497974-35535038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35511165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 150 (D150E)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116436
AA Change: D150E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: D150E

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,738,702 L1027* probably null Het
Actl11 T A 9: 107,931,310 M944K possibly damaging Het
Afap1l2 T C 19: 56,917,995 K491E probably damaging Het
Arhgef1 T A 7: 24,907,879 L17Q probably damaging Het
Bysl A G 17: 47,604,317 S169P Het
C4b A T 17: 34,729,430 F1610I probably damaging Het
Chtf8 C A 8: 106,885,849 A153S probably benign Het
Ciapin1 C T 8: 94,831,772 probably null Het
Cnnm1 A G 19: 43,440,956 E171G possibly damaging Het
Crybb3 T C 5: 113,077,541 N155S probably benign Het
Dclk3 T A 9: 111,488,615 M773K probably benign Het
Ddx18 A T 1: 121,561,538 V260D probably damaging Het
Dmxl2 T A 9: 54,400,037 N2216Y Het
Epn2 T C 11: 61,546,620 E42G probably damaging Het
Esrrg C A 1: 188,146,408 P229T probably benign Het
Esrrg C A 1: 188,146,409 P229Q possibly damaging Het
Ethe1 G T 7: 24,606,218 R130L probably benign Het
Fgl2 G A 5: 21,375,365 C235Y probably damaging Het
Fmnl1 C T 11: 103,196,501 T890M unknown Het
Fsip2 C G 2: 82,976,957 P1207A probably benign Het
Gc C T 5: 89,445,306 D85N possibly damaging Het
Gfi1 G A 5: 107,721,504 R287W probably damaging Het
Gm3460 T C 14: 6,619,567 probably null Het
Hapln3 A G 7: 79,121,964 F59S probably benign Het
Il24 G A 1: 130,885,746 T38I possibly damaging Het
Izumo1 A G 7: 45,627,159 D382G probably benign Het
Kdm5a T A 6: 120,405,926 Y739* probably null Het
Kif2b T A 11: 91,575,712 I582F possibly damaging Het
Klhdc1 A G 12: 69,242,009 Y31C probably damaging Het
Lama1 G A 17: 67,821,674 E3009K Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Mark1 A C 1: 184,912,064 S468A probably damaging Het
Mknk2 T A 10: 80,668,989 N236Y probably damaging Het
Muc2 T A 7: 141,701,414 C251* probably null Het
Nacad T C 11: 6,602,252 D313G probably damaging Het
Neb G T 2: 52,209,587 D4750E probably benign Het
Nlrp6 T C 7: 140,926,419 S758P probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr61 A C 7: 140,638,369 I223L probably benign Het
Olfr66 T C 7: 103,881,362 T294A possibly damaging Het
Olfr918 A G 9: 38,672,596 F283L probably benign Het
Oxtr A G 6: 112,489,520 V93A probably damaging Het
Pbx3 C A 2: 34,213,259 D234Y probably damaging Het
Pde4b A T 4: 102,602,629 T554S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pid1 A T 1: 84,038,234 Y151N probably damaging Het
Plcd4 A G 1: 74,552,148 E234G possibly damaging Het
Pou6f1 A G 15: 100,580,908 V373A probably benign Het
Ppp1r12c T C 7: 4,482,793 K685E possibly damaging Het
Rnf34 T A 5: 122,861,894 V71D probably damaging Het
Rpap2 T G 5: 107,598,290 H11Q possibly damaging Het
Skint2 A G 4: 112,639,637 T247A probably benign Het
Stat5b T A 11: 100,801,524 N145Y probably damaging Het
Sv2b A G 7: 75,206,269 L91P probably damaging Het
Syt1 A G 10: 108,504,515 I314T probably damaging Het
Tlk1 A T 2: 70,742,158 N355K probably benign Het
Tnc C A 4: 63,972,736 M1636I probably benign Het
Trank1 C A 9: 111,333,775 A34D probably damaging Het
Unc13c A G 9: 73,812,383 I1001T probably benign Het
Vdr T C 15: 97,867,255 D201G probably benign Het
Vmn2r115 A T 17: 23,345,333 I160L probably benign Het
Wdr81 C A 11: 75,444,424 R1772L probably damaging Het
Zfp457 T C 13: 67,294,004 D169G probably benign Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
BB002:Ahr UTSW 12 35515068 nonsense probably null
BB012:Ahr UTSW 12 35515068 nonsense probably null
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R0784:Ahr UTSW 12 35508142 missense possibly damaging 0.79
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
R7925:Ahr UTSW 12 35515068 nonsense probably null
R8179:Ahr UTSW 12 35510051 missense probably benign 0.01
R8274:Ahr UTSW 12 35510069 missense probably benign
R8342:Ahr UTSW 12 35508272 missense probably damaging 1.00
R8985:Ahr UTSW 12 35526737 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCCTATCTTCAGCATGGAGC -3'
(R):5'- AACAGGAAGCTGCCTTGTG -3'

Sequencing Primer
(F):5'- GGAGCTCTATGCCTTTCTTTCATAG -3'
(R):5'- AAGCTGCCTTGTGAGCCAGAG -3'
Posted On 2021-12-30