Incidental Mutation 'R9115:Olfr1098'
ID 692454
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Name olfactory receptor 1098
Synonyms MOR206-1, GA_x6K02T2Q125-48410458-48409511
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9115 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 86920949-86924545 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86922654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 293 (R293W)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
AlphaFold A2AVB0
Predicted Effect probably damaging
Transcript: ENSMUST00000099872
AA Change: R293W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: R293W

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111574
AA Change: R293W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: R293W

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,329 V1573I possibly damaging Het
Aire T C 10: 78,043,475 T17A Het
Ankrd31 T C 13: 96,804,265 probably null Het
Brwd1 C T 16: 96,047,114 R569K probably damaging Het
Capns1 A T 7: 30,190,553 I177K probably benign Het
Ccdc182 A G 11: 88,294,517 N141S probably benign Het
Celsr1 A G 15: 85,919,016 W2441R probably damaging Het
Cftr A T 6: 18,235,311 R516S probably damaging Het
Ckap4 C T 10: 84,527,643 V519M probably damaging Het
Col27a1 C T 4: 63,313,737 P1277L unknown Het
Cspg4 T C 9: 56,890,452 L1400P probably damaging Het
Cyp4f39 T A 17: 32,492,322 F481Y probably damaging Het
Dmxl2 T C 9: 54,401,727 I1913M probably benign Het
Dock10 T C 1: 80,512,439 T1989A probably damaging Het
Eef2 CC CCC 10: 81,178,769 probably null Het
Fshr T A 17: 88,985,520 I577F probably damaging Het
Gfm2 T C 13: 97,165,199 probably null Het
Gm12695 T C 4: 96,769,609 N108D possibly damaging Het
Gm3285 T A 10: 77,862,173 L52H unknown Het
Gm5930 A T 14: 44,337,549 L95* probably null Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Klhl26 A G 8: 70,452,246 M338T possibly damaging Het
Lrrc4c T C 2: 97,629,341 I104T probably benign Het
Mapk10 A T 5: 103,038,666 V60E Het
Mfsd4b3 T A 10: 39,948,016 K83* probably null Het
Muc15 C T 2: 110,731,744 T175I probably damaging Het
Nmu G A 5: 76,363,725 probably benign Het
Nol4l G T 2: 153,411,718 T645K probably damaging Het
Nr2f1 A G 13: 78,189,750 S416P probably benign Het
Ntn4 A C 10: 93,733,813 I463L probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr360 T C 2: 37,069,040 L245P probably damaging Het
Olfr649 C A 7: 104,189,724 C161F possibly damaging Het
Pccb T A 9: 100,987,855 N341I probably damaging Het
Pgm3 G A 9: 86,565,609 L194F probably damaging Het
Prkra T A 2: 76,647,849 H3L probably benign Het
Rbm12 TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,110 probably benign Het
Ryr1 T A 7: 29,104,564 K600* probably null Het
Sema4d A T 13: 51,723,560 S79T probably benign Het
Slc37a1 T C 17: 31,315,512 C53R probably damaging Het
Sptbn1 A G 11: 30,137,526 I971T probably damaging Het
Tcstv1 T A 13: 119,893,917 I60F possibly damaging Het
Tdrkh G T 3: 94,428,291 C397F possibly damaging Het
Tecrl A T 5: 83,280,059 M314K possibly damaging Het
Ttn T C 2: 76,950,152 K1131R unknown Het
Uimc1 A T 13: 55,050,771 Y531N possibly damaging Het
Usp5 A G 6: 124,826,421 S39P probably damaging Het
Virma A G 4: 11,498,744 T62A probably benign Het
Vmn2r85 A G 10: 130,418,284 Y844H probably benign Het
Yars T C 4: 129,215,350 V458A probably benign Het
Zfp235 G A 7: 24,142,028 C624Y probably damaging Het
Zfp712 A T 13: 67,041,177 S429T probably damaging Het
Zmynd11 A T 13: 9,693,459 D307E probably damaging Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 splice site probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R2368:Olfr1098 UTSW 2 86923107 missense probably benign
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3425:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4156:Olfr1098 UTSW 2 86922878 missense probably damaging 1.00
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R5942:Olfr1098 UTSW 2 86923406 missense probably damaging 1.00
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6517:Olfr1098 UTSW 2 86923097 missense probably benign 0.05
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
R8058:Olfr1098 UTSW 2 86922807 missense probably benign 0.32
R8234:Olfr1098 UTSW 2 86922969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATTCTGAGATATGCCCAAAC -3'
(R):5'- TTCTTCTTCAGGAAAGCACAAAGC -3'

Sequencing Primer
(F):5'- GCCCAAACTATATTTTTCTAGGGGAG -3'
(R):5'- GCACAAAGCCTTCTCTACATGTG -3'
Posted On 2021-12-30