Incidental Mutation 'R9115:Ntn4'
ID 692484
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9115 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 93733813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 463 (I463L)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
AlphaFold Q9JI33
Predicted Effect probably benign
Transcript: ENSMUST00000020204
AA Change: I463L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: I463L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,154,329 V1573I possibly damaging Het
Aire T C 10: 78,043,475 T17A Het
Ankrd31 T C 13: 96,804,265 probably null Het
Brwd1 C T 16: 96,047,114 R569K probably damaging Het
Capns1 A T 7: 30,190,553 I177K probably benign Het
Ccdc182 A G 11: 88,294,517 N141S probably benign Het
Celsr1 A G 15: 85,919,016 W2441R probably damaging Het
Cftr A T 6: 18,235,311 R516S probably damaging Het
Ckap4 C T 10: 84,527,643 V519M probably damaging Het
Col27a1 C T 4: 63,313,737 P1277L unknown Het
Cspg4 T C 9: 56,890,452 L1400P probably damaging Het
Cyp4f39 T A 17: 32,492,322 F481Y probably damaging Het
Dmxl2 T C 9: 54,401,727 I1913M probably benign Het
Dock10 T C 1: 80,512,439 T1989A probably damaging Het
Eef2 CC CCC 10: 81,178,769 probably null Het
Fshr T A 17: 88,985,520 I577F probably damaging Het
Gfm2 T C 13: 97,165,199 probably null Het
Gm12695 T C 4: 96,769,609 N108D possibly damaging Het
Gm3285 T A 10: 77,862,173 L52H unknown Het
Gm5930 A T 14: 44,337,549 L95* probably null Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Klhl26 A G 8: 70,452,246 M338T possibly damaging Het
Lrrc4c T C 2: 97,629,341 I104T probably benign Het
Mapk10 A T 5: 103,038,666 V60E Het
Mfsd4b3 T A 10: 39,948,016 K83* probably null Het
Muc15 C T 2: 110,731,744 T175I probably damaging Het
Nmu G A 5: 76,363,725 probably benign Het
Nol4l G T 2: 153,411,718 T645K probably damaging Het
Nr2f1 A G 13: 78,189,750 S416P probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1098 T A 2: 86,922,654 R293W probably damaging Het
Olfr360 T C 2: 37,069,040 L245P probably damaging Het
Olfr649 C A 7: 104,189,724 C161F possibly damaging Het
Pccb T A 9: 100,987,855 N341I probably damaging Het
Pgm3 G A 9: 86,565,609 L194F probably damaging Het
Prkra T A 2: 76,647,849 H3L probably benign Het
Rbm12 TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,110 probably benign Het
Ryr1 T A 7: 29,104,564 K600* probably null Het
Sema4d A T 13: 51,723,560 S79T probably benign Het
Slc37a1 T C 17: 31,315,512 C53R probably damaging Het
Sptbn1 A G 11: 30,137,526 I971T probably damaging Het
Tcstv1 T A 13: 119,893,917 I60F possibly damaging Het
Tdrkh G T 3: 94,428,291 C397F possibly damaging Het
Tecrl A T 5: 83,280,059 M314K possibly damaging Het
Ttn T C 2: 76,950,152 K1131R unknown Het
Uimc1 A T 13: 55,050,771 Y531N possibly damaging Het
Usp5 A G 6: 124,826,421 S39P probably damaging Het
Virma A G 4: 11,498,744 T62A probably benign Het
Vmn2r85 A G 10: 130,418,284 Y844H probably benign Het
Yars T C 4: 129,215,350 V458A probably benign Het
Zfp235 G A 7: 24,142,028 C624Y probably damaging Het
Zfp712 A T 13: 67,041,177 S429T probably damaging Het
Zmynd11 A T 13: 9,693,459 D307E probably damaging Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTCAGTGACCTTCTGC -3'
(R):5'- CAGTGCTGTGTTAAGAGACTACTG -3'

Sequencing Primer
(F):5'- TTCTGCGACCCCAGCAATG -3'
(R):5'- TTGCAAAATGAATTAGGCGATCCCC -3'
Posted On 2021-12-30