Incidental Mutation 'R9116:Cr2'
ID 692506
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9116 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 194840977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 438 (Y438*)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000082321
AA Change: Y438*
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: Y438*

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193356
AA Change: Y141*
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: Y141*

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195120
AA Change: Y438*
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: Y438*

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210219
AA Change: Y814*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,838,973 (GRCm39) L689Q Het
Abcc2 G A 19: 43,793,391 (GRCm39) V348M probably benign Het
Abhd5 T C 9: 122,196,992 (GRCm39) S60P probably benign Het
Adamts10 C A 17: 33,756,330 (GRCm39) H324Q probably benign Het
Akap1 A G 11: 88,723,165 (GRCm39) L823P probably damaging Het
Aoc1 G A 6: 48,885,522 (GRCm39) V676I probably damaging Het
Arhgef12 T C 9: 42,893,241 (GRCm39) probably benign Het
Arl4d A C 11: 101,557,620 (GRCm39) S49R possibly damaging Het
Atr A G 9: 95,747,851 (GRCm39) I378V probably benign Het
Bicd1 G A 6: 149,385,674 (GRCm39) V136I probably benign Het
Brd1 A T 15: 88,585,374 (GRCm39) L820H possibly damaging Het
Cfap70 T C 14: 20,497,590 (GRCm39) T55A probably benign Het
Cog7 G T 7: 121,570,561 (GRCm39) N182K probably damaging Het
Col4a4 T A 1: 82,431,752 (GRCm39) T1511S unknown Het
Ctnnbl1 T A 2: 157,648,623 (GRCm39) V198E probably damaging Het
Fam117b C T 1: 60,018,456 (GRCm39) Q58* probably null Het
Fam171a2 A G 11: 102,330,519 (GRCm39) Y288H probably damaging Het
Fam186a A T 15: 99,840,472 (GRCm39) I1924K possibly damaging Het
Fancd2 A G 6: 113,532,180 (GRCm39) I498V probably benign Het
Fat3 T A 9: 15,909,421 (GRCm39) I2194F probably benign Het
Flg2 T C 3: 93,109,591 (GRCm39) S540P unknown Het
Gbp9 T C 5: 105,231,695 (GRCm39) Y297C Het
Gck T G 11: 5,854,377 (GRCm39) N283H possibly damaging Het
Gm13941 A T 2: 110,935,146 (GRCm39) L28Q unknown Het
Gpr155 A G 2: 73,204,109 (GRCm39) I235T possibly damaging Het
Junb A C 8: 85,704,052 (GRCm39) L336R probably damaging Het
Krt14 A T 11: 100,095,904 (GRCm39) M218K probably benign Het
Leprotl1 A G 8: 34,604,967 (GRCm39) V102A probably benign Het
Lrrc8d T C 5: 105,961,908 (GRCm39) F773L probably damaging Het
Mad2l1bp G A 17: 46,458,958 (GRCm39) R191C probably damaging Het
Man1c1 C T 4: 134,311,705 (GRCm39) V274M possibly damaging Het
Mtor C A 4: 148,637,198 (GRCm39) P2466T probably benign Het
Mycbpap C A 11: 94,398,032 (GRCm39) probably benign Het
Myef2l G A 3: 10,153,593 (GRCm39) V121M probably damaging Het
Myo18b T C 5: 112,975,862 (GRCm39) E1329G probably damaging Het
Nipbl A T 15: 8,380,340 (GRCm39) D817E probably benign Het
Nthl1 C T 17: 24,853,753 (GRCm39) Q133* probably null Het
Nup133 A G 8: 124,660,155 (GRCm39) M381T probably benign Het
Or13c7 T C 4: 43,854,602 (GRCm39) C98R probably damaging Het
Or2j3 T C 17: 38,615,654 (GRCm39) T233A probably benign Het
Or51t4 T C 7: 102,598,527 (GRCm39) I285T possibly damaging Het
Or7e175 T C 9: 20,048,633 (GRCm39) Y74H probably damaging Het
Or7g20 T C 9: 18,946,773 (GRCm39) M118T probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pmpcb A T 5: 21,961,608 (GRCm39) I422F probably damaging Het
Prpf8 T A 11: 75,380,589 (GRCm39) H97Q possibly damaging Het
Psat1 A G 19: 15,898,332 (GRCm39) L30P probably damaging Het
Rag1 T C 2: 101,472,820 (GRCm39) D774G probably damaging Het
Rag1 C T 2: 101,475,137 (GRCm39) A2T probably benign Het
Rccd1 G T 7: 79,970,728 (GRCm39) F17L probably damaging Het
Rhobtb1 T A 10: 69,106,579 (GRCm39) D443E probably damaging Het
Rnf13 A G 3: 57,709,866 (GRCm39) probably null Het
Ryr2 A G 13: 11,587,185 (GRCm39) S4699P possibly damaging Het
Scart1 A G 7: 139,808,277 (GRCm39) T754A probably benign Het
Sdc3 T C 4: 130,546,352 (GRCm39) V237A probably benign Het
Serinc5 T A 13: 92,797,514 (GRCm39) probably benign Het
Sertad4 A G 1: 192,528,973 (GRCm39) I281T probably benign Het
Shroom1 T C 11: 53,354,490 (GRCm39) S137P probably damaging Het
Slurp1 C T 15: 74,599,450 (GRCm39) G20D probably damaging Het
Sncb T A 13: 54,910,512 (GRCm39) N75Y probably damaging Het
Spag8 C T 4: 43,653,231 (GRCm39) G77S unknown Het
Spink14 A T 18: 44,164,059 (GRCm39) I76F probably damaging Het
Srfbp1 A T 18: 52,623,102 (GRCm39) E372D possibly damaging Het
Synpo A T 18: 60,735,599 (GRCm39) N782K probably damaging Het
Syt7 T C 19: 10,421,373 (GRCm39) M519T probably damaging Het
Tlr5 C T 1: 182,802,160 (GRCm39) P488L probably benign Het
Tmod3 A T 9: 75,412,202 (GRCm39) I315N probably damaging Het
Ttc12 T C 9: 49,364,757 (GRCm39) M340V probably benign Het
Ttn T A 2: 76,710,959 (GRCm39) I8392F unknown Het
Ttn A G 2: 76,769,232 (GRCm39) V2822A unknown Het
Ube3b C T 5: 114,542,837 (GRCm39) probably benign Het
Ubr4 C A 4: 139,145,785 (GRCm39) N238K Het
Vmn2r12 T C 5: 109,233,885 (GRCm39) T776A probably damaging Het
Vps50 G A 6: 3,588,091 (GRCm39) probably benign Het
Vwa3a A G 7: 120,366,470 (GRCm39) D165G Het
Wdr17 T A 8: 55,114,605 (GRCm39) H644L probably damaging Het
Zfp628 T C 7: 4,924,202 (GRCm39) V808A probably benign Het
Zscan21 T A 5: 138,123,937 (GRCm39) D205E probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGATTCTGAGGCCTCTTAAAGAG -3'
(R):5'- GACAACTGCCATGCAAATGG -3'

Sequencing Primer
(F):5'- AAAGAGATGTGGTCCTACTGGCTTAC -3'
(R):5'- CAACTGCCATGCAAATGGTATTATC -3'
Posted On 2021-12-30