Incidental Mutation 'R9116:Cr2'
ID 692506
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R9116 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 195158669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 438 (Y438*)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000082321
AA Change: Y438*
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: Y438*

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193356
AA Change: Y141*
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: Y141*

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195120
AA Change: Y438*
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: Y438*

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210219
AA Change: Y814*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,003,139 L689Q Het
Abcc2 G A 19: 43,804,952 V348M probably benign Het
Abhd5 T C 9: 122,367,927 S60P probably benign Het
Adamts10 C A 17: 33,537,356 H324Q probably benign Het
Akap1 A G 11: 88,832,339 L823P probably damaging Het
Aoc1 G A 6: 48,908,588 V676I probably damaging Het
Arhgef12 T C 9: 42,981,945 probably benign Het
Arl4d A C 11: 101,666,794 S49R possibly damaging Het
Atr A G 9: 95,865,798 I378V probably benign Het
Bicd1 G A 6: 149,484,176 V136I probably benign Het
Brd1 A T 15: 88,701,171 L820H possibly damaging Het
Cd163l1 A G 7: 140,228,364 T754A probably benign Het
Cfap70 T C 14: 20,447,522 T55A probably benign Het
Cog7 G T 7: 121,971,338 N182K probably damaging Het
Col4a4 T A 1: 82,454,031 T1511S unknown Het
Ctnnbl1 T A 2: 157,806,703 V198E probably damaging Het
Fam117b C T 1: 59,979,297 Q58* probably null Het
Fam171a2 A G 11: 102,439,693 Y288H probably damaging Het
Fam186a A T 15: 99,942,591 I1924K possibly damaging Het
Fancd2 A G 6: 113,555,219 I498V probably benign Het
Fat3 T A 9: 15,998,125 I2194F probably benign Het
Flg2 T C 3: 93,202,284 S540P unknown Het
Gbp9 T C 5: 105,083,829 Y297C Het
Gck T G 11: 5,904,377 N283H possibly damaging Het
Gm13941 A T 2: 111,104,801 L28Q unknown Het
Gm9833 G A 3: 10,088,533 V121M probably damaging Het
Gpr155 A G 2: 73,373,765 I235T possibly damaging Het
Junb A C 8: 84,977,423 L336R probably damaging Het
Krt14 A T 11: 100,205,078 M218K probably benign Het
Leprotl1 A G 8: 34,137,813 V102A probably benign Het
Lrrc8d T C 5: 105,814,042 F773L probably damaging Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Man1c1 C T 4: 134,584,394 V274M possibly damaging Het
Mtor C A 4: 148,552,741 P2466T probably benign Het
Mycbpap C A 11: 94,507,206 probably benign Het
Myo18b T C 5: 112,827,996 E1329G probably damaging Het
Nipbl A T 15: 8,350,856 D817E probably benign Het
Nthl1 C T 17: 24,634,779 Q133* probably null Het
Nup133 A G 8: 123,933,416 M381T probably benign Het
Olfr137 T C 17: 38,304,763 T233A probably benign Het
Olfr155 T C 4: 43,854,602 C98R probably damaging Het
Olfr574 T C 7: 102,949,320 I285T possibly damaging Het
Olfr835 T C 9: 19,035,477 M118T probably damaging Het
Olfr869 T C 9: 20,137,337 Y74H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pmpcb A T 5: 21,756,610 I422F probably damaging Het
Prpf8 T A 11: 75,489,763 H97Q possibly damaging Het
Psat1 A G 19: 15,920,968 L30P probably damaging Het
Rag1 T C 2: 101,642,475 D774G probably damaging Het
Rag1 C T 2: 101,644,792 A2T probably benign Het
Rccd1 G T 7: 80,320,980 F17L probably damaging Het
Rhobtb1 T A 10: 69,270,749 D443E probably damaging Het
Rnf13 A G 3: 57,802,445 probably null Het
Ryr2 A G 13: 11,572,299 S4699P possibly damaging Het
Sdc3 T C 4: 130,819,041 V237A probably benign Het
Serinc5 T A 13: 92,661,006 probably benign Het
Sertad4 A G 1: 192,846,665 I281T probably benign Het
Shroom1 T C 11: 53,463,663 S137P probably damaging Het
Slurp1 C T 15: 74,727,601 G20D probably damaging Het
Sncb T A 13: 54,762,699 N75Y probably damaging Het
Spag8 C T 4: 43,653,231 G77S unknown Het
Spink14 A T 18: 44,030,992 I76F probably damaging Het
Srfbp1 A T 18: 52,490,030 E372D possibly damaging Het
Synpo A T 18: 60,602,527 N782K probably damaging Het
Syt7 T C 19: 10,444,009 M519T probably damaging Het
Tlr5 C T 1: 182,974,595 P488L probably benign Het
Tmod3 A T 9: 75,504,920 I315N probably damaging Het
Ttc12 T C 9: 49,453,457 M340V probably benign Het
Ttn T A 2: 76,880,615 I8392F unknown Het
Ttn A G 2: 76,938,888 V2822A unknown Het
Ube3b C T 5: 114,404,776 probably benign Het
Ubr4 C A 4: 139,418,474 N238K Het
Vmn2r12 T C 5: 109,086,019 T776A probably damaging Het
Vps50 G A 6: 3,588,091 probably benign Het
Vwa3a A G 7: 120,767,247 D165G Het
Wdr17 T A 8: 54,661,570 H644L probably damaging Het
Zfp628 T C 7: 4,921,203 V808A probably benign Het
Zscan21 T A 5: 138,125,675 D205E probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8896:Cr2 UTSW 1 195169273 missense possibly damaging 0.58
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9497:Cr2 UTSW 1 195168435 missense probably damaging 0.99
R9510:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGATTCTGAGGCCTCTTAAAGAG -3'
(R):5'- GACAACTGCCATGCAAATGG -3'

Sequencing Primer
(F):5'- AAAGAGATGTGGTCCTACTGGCTTAC -3'
(R):5'- CAACTGCCATGCAAATGGTATTATC -3'
Posted On 2021-12-30