Incidental Mutation 'R9116:Olfr835'
ID 692544
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor 835
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R9116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19032735-19037670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19035477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 118 (M118T)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: M118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: M118T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: M118T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,003,139 L689Q Het
Abcc2 G A 19: 43,804,952 V348M probably benign Het
Abhd5 T C 9: 122,367,927 S60P probably benign Het
Adamts10 C A 17: 33,537,356 H324Q probably benign Het
Akap1 A G 11: 88,832,339 L823P probably damaging Het
Aoc1 G A 6: 48,908,588 V676I probably damaging Het
Arl4d A C 11: 101,666,794 S49R possibly damaging Het
Atr A G 9: 95,865,798 I378V probably benign Het
Bicd1 G A 6: 149,484,176 V136I probably benign Het
Brd1 A T 15: 88,701,171 L820H possibly damaging Het
Cd163l1 A G 7: 140,228,364 T754A probably benign Het
Cfap70 T C 14: 20,447,522 T55A probably benign Het
Cog7 G T 7: 121,971,338 N182K probably damaging Het
Col4a4 T A 1: 82,454,031 T1511S unknown Het
Cr2 A T 1: 195,158,669 Y438* probably null Het
Ctnnbl1 T A 2: 157,806,703 V198E probably damaging Het
Fam171a2 A G 11: 102,439,693 Y288H probably damaging Het
Fam186a A T 15: 99,942,591 I1924K possibly damaging Het
Fancd2 A G 6: 113,555,219 I498V probably benign Het
Fat3 T A 9: 15,998,125 I2194F probably benign Het
Flg2 T C 3: 93,202,284 S540P unknown Het
Gbp9 T C 5: 105,083,829 Y297C Het
Gck T G 11: 5,904,377 N283H possibly damaging Het
Gm13941 A T 2: 111,104,801 L28Q unknown Het
Gm9833 G A 3: 10,088,533 V121M probably damaging Het
Gpr155 A G 2: 73,373,765 I235T possibly damaging Het
Junb A C 8: 84,977,423 L336R probably damaging Het
Krt14 A T 11: 100,205,078 M218K probably benign Het
Leprotl1 A G 8: 34,137,813 V102A probably benign Het
Lrrc8d T C 5: 105,814,042 F773L probably damaging Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Man1c1 C T 4: 134,584,394 V274M possibly damaging Het
Mtor C A 4: 148,552,741 P2466T probably benign Het
Mycbpap C A 11: 94,507,206 probably benign Het
Myo18b T C 5: 112,827,996 E1329G probably damaging Het
Nipbl A T 15: 8,350,856 D817E probably benign Het
Nthl1 C T 17: 24,634,779 Q133* probably null Het
Nup133 A G 8: 123,933,416 M381T probably benign Het
Olfr137 T C 17: 38,304,763 T233A probably benign Het
Olfr155 T C 4: 43,854,602 C98R probably damaging Het
Olfr574 T C 7: 102,949,320 I285T possibly damaging Het
Olfr869 T C 9: 20,137,337 Y74H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pmpcb A T 5: 21,756,610 I422F probably damaging Het
Prpf8 T A 11: 75,489,763 H97Q possibly damaging Het
Psat1 A G 19: 15,920,968 L30P probably damaging Het
Rag1 T C 2: 101,642,475 D774G probably damaging Het
Rag1 C T 2: 101,644,792 A2T probably benign Het
Rccd1 G T 7: 80,320,980 F17L probably damaging Het
Rhobtb1 T A 10: 69,270,749 D443E probably damaging Het
Rnf13 A G 3: 57,802,445 probably null Het
Ryr2 A G 13: 11,572,299 S4699P possibly damaging Het
Sdc3 T C 4: 130,819,041 V237A probably benign Het
Sertad4 A G 1: 192,846,665 I281T probably benign Het
Shroom1 T C 11: 53,463,663 S137P probably damaging Het
Slurp1 C T 15: 74,727,601 G20D probably damaging Het
Sncb T A 13: 54,762,699 N75Y probably damaging Het
Spag8 C T 4: 43,653,231 G77S unknown Het
Spink14 A T 18: 44,030,992 I76F probably damaging Het
Srfbp1 A T 18: 52,490,030 E372D possibly damaging Het
Synpo A T 18: 60,602,527 N782K probably damaging Het
Syt7 T C 19: 10,444,009 M519T probably damaging Het
Tlr5 C T 1: 182,974,595 P488L probably benign Het
Tmod3 A T 9: 75,504,920 I315N probably damaging Het
Ttc12 T C 9: 49,453,457 M340V probably benign Het
Ttn T A 2: 76,880,615 I8392F unknown Het
Ttn A G 2: 76,938,888 V2822A unknown Het
Ubr4 C A 4: 139,418,474 N238K Het
Vmn2r12 T C 5: 109,086,019 T776A probably damaging Het
Vwa3a A G 7: 120,767,247 D165G Het
Wdr17 T A 8: 54,661,570 H644L probably damaging Het
Zfp628 T C 7: 4,921,203 V808A probably benign Het
Zscan21 T A 5: 138,125,675 D205E probably damaging Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
R8736:Olfr835 UTSW 9 19035478 missense probably damaging 1.00
R8868:Olfr835 UTSW 9 19035482 missense probably damaging 1.00
R8909:Olfr835 UTSW 9 19035592 missense probably benign 0.08
R9479:Olfr835 UTSW 9 19035434 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCATTTGCAAACACCCATGTAC -3'
(R):5'- GCTTCATGACCTGAGAAAGTTCAC -3'

Sequencing Primer
(F):5'- CAGGATCAGAGCATCAGT -3'
(R):5'- TCATGACCTGAGAAAGTTCACAGAAG -3'
Posted On 2021-12-30